GenePrediction:GLEAN_2962 Details

Name: GLEAN_2962
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:161842..163663 (+ strand)
Length: 1822
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:161842..161947 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_124:162051..163299 (+ strand)
Length: 1249
Type: CDS
Source: GLEAN
Position: GCSC_124:163351..163663 (+ strand)
Length: 313
>GLEAN_2962 class=GenePrediction position=GCSC_124:161842..163663 (+ strand)
ATGTCTGGCATGGCCGGCCCTGCCGCCGTCGACGACATTATCAGCCAGTTCGACCTGTCCTCGACCGCCCTGCAGACCAT
CACAGACCATTTCGTCTCGCAGCTGAGTAGGTAGGCCACCGTTCCTTTTCCCACCGATATTTTTGCTCTTGGTGGGACGC
CTGCAATCGAGGCTAACTGCGGGTCGTGTCTTGCTGTCTATTTGAATAGAGCTTGGGCTGCTCGACTCTAATTTGCCCTT
TCAGCTTCCCGCCTTCGTCACTGCCATCCCAGATGGCACTGAGACGGGGCGTTTTCTCTCCGTCGATCTCGGCGGCACCA
ACTGCCGCATCTGCATGGTCGATCTCCACGGCCATGGCTCCTTCTCCGTAGTGCAGGAGAAGCACACCGTGCCGCGCTAC
GTCATGGTCAATTCGCGATACGATCCGCTCTTCTCCTGGCTGGCAGCACAGATCGGCACGTTTGCCCAGGCCCAGAAACT
CTTTCCCCAAGCTGGCTCCGATGCCGCTACGAAAGATAGGAAGGTGCCGCTTGGGTTTACCTTCTCCTTCACGTGTGACC
AGGTCTCACTCGCATCCGGCACGCTGCTGCACTGGGACAAGGGCTGGGATATCCCATCTGCCCTAGGACGCGACCCCTGC
CAGTTGCTCCAGGAAGCTCTCGATTCCGCAAACATCCCTGTCCGTGTGACTGCACTGGCAAACGACAGCGTCGGCACTCT
GTTAGCCCAAGCGTACACGTCAGGGGGCCAGCAAGCGACGACGGCCAAGACGTTGGCCGGCATGATTGTCGGCACCGGCA
CCAATGCTGCGTATGTCGAGCGTCTGCGCCACGTTAAAAGACACGGCGTAGAAGCCGAAAGGGCCAGCCTTGACGATGTT
ATGATTATCAATACCGAGTGGGGATGCCTGGACGACAGCTTGATTGTACTCCCGCGAACACGCTTCGACGACGAGTTGGA
TGCCCATTCGACTGACCGAGGCAGCCAGATGCTCGAAAAGCGGGTATCAGGAATGTACCTGGGCGAGCTGTTTCGACTGG
CCGTGGAGGAGTTGTACCGGCTTAATAACGTGTTCGATTTCGTCGTTGCGGACAACTCGACATTGCTCCGGATGGCAGGC
GTCGACTCCTCGCTTCTCTCGTTGCTAGCGGATAGCTCTTTGGATGACGAGGCAAAAACAAAGTTGGTTGCAACAACTCT
CGCTCTCCAGGACACGTCGTCAAAAGATCTTGCAATTCTCCAGCGAATTTCGGCCGCCATCATGACGCGAGCTGCCCGGC
TAGTTGGGGCTGCACTGGCAGCCATCGTCATACAGTCTGGCCACCTCGGAGACGGGGTGCATGTGGACGAATCATCGCCG
TCTCCGTCTCCTAGCTTTCCAAAGACCGTTGCCGACGACAGCAAGTTCTACTTGGGCACTTTGGAGCCTCCAAATTTGGG
GCGAAACAAGGAGCGCAGGTGTGGGATTTTCGGCTTCTTGAAACGTCTCCTCTTCTCTTGCTTGAATAGAAACTCGGCTT
CGCCAGCAGAAGCCGAATCGTCCATTGTACCACCACCTAAATCGACTCATAATTTGCACCTGTCTGCCGTTCAAGGTGAC
GGACGGACACAGACACGCGAGGCGGATACAATTGATATCGGGGTTACTGGGTCCGTGATAGAATATTACCCAACATTCGA
GGCTGAGATGAGGGCCGCGCTGCAAGAGATTTCCGGCATTGGGCCTCAGGGTGAGAAGAGGATTCGAGCGGGCGTCTGCA
AGGATGGCAGTGCTGTCGGCGCAGCACTGATGGCACAGGCAGCCCTGTCGACAAAAGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62