GenePrediction:GLEAN_2965 Details

Name: GLEAN_2965
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:177071..178616 (+ strand)
Length: 1546
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:177071..177148 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_124:177492..178616 (+ strand)
Length: 1125
>GLEAN_2965 class=GenePrediction position=GCSC_124:177071..178616 (+ strand)
ATGGACCAGCGGGCGGCTAAGGTGGGACATCGAAAGTCACGCAAGGGGTGCAGCAAGTGTAAGATACGGAGAGTGAAGGT
GAGTGGATGAGTGAACGTGCAACGTTGTGTTTTGAATTTTAACGGGACAGTGCGATGAGGTGCGACCAGTGTGCAGCAAT
TGTTCACGACTGAAGTTGGCCTGCTCGTGGCCGGTGCTGGAGCGAGGGCAGACGGGAGAGCATGGAGAGAAAGGAGAGGC
AGGGCTGAGAGGGAAAAGAGAGACATTGCATCCTTCGCATCCACCACATCCATCAAATCCAGCACATAAAAACACCAGAT
CGCCAACCGGCTTCTCGGCCGCGTCCACAGACGTCGAGGGTGCGTCTTCGAGAGAGTCGGCACCACTCTCAGCGCTGCTG
CGGATGTGGACGCCGCAAGAGGGGGACGCAGACGTGTTTTTAGTGCCGGAGTCGGTGGCGGACGAGTTCTCGCTACCAGA
ATCGCGGGCGCGGCGGCTGATGGAGCACCGGCTGATGCAGAACTACATCCTGCACCTGTCGGAGCCACTTCCAATGTCGC
CGAGCGCAGAGTGGAACGCGCTGTGGCAGAAGCAGCTACCTCCGCTGGCGCTGCAGCACGACAACCTGCTCTATGCGCTG
CTAGCGATGTCAGCGACGAGTCTATTGGGGGCTGGGGAGGATGAGAGCAGGAAGGGGGACGAGCATGGAAGTGGTGACTC
GAGCGGAAGCTCTAGTGAGACTTCCAGCGGTAACTCTGGTTCCGGCAGCAATGTCGAGCGGAAGGAGCTCTTCACAGTCC
GGCAGGCGTACTTGATCGCGGCCATGGGCGAGCAGCGACGCATGGTGCAGTCGCTGACGCTGGCGAGTGCAGACGCGGTC
TGTCTCTCGTCGCTGCTGATGCTGATCAACGCGTTTGCGATGCTGGGCGAGCGCGTGGTCCAGCCGTACACGCCGCCGAC
CGAGTGGCTGCAGCTGGGTCGTGGCTCAGGTGCCGTTGTCTGGCTCAGCGTCGAGGCCATCCAGCAGTCGGGCGAGGCCG
ATCGGTCGGTCATGTGCACGATTGCAAACGCGCCTCCGCAGTTTGGCCTGGACGAGTCGTACTTTGACGCCAGCAACCGG
GAGCAATTCGGGGCTCTTTTGGCGACGGAGGCGACGACAGCCTCGGCTTCAGAACCGTCCGATCCTGACGACGAGACCAC
ACGCCTGGCCTACGAACAGACGCTCGCATATGTCGGGTCCATCTACAAGGCCATCCGGCGCCGTGAACCCGTCTATGTGA
TATCCCGTCGCGTCCAGGGCTTCACCATGGTGGTTCCGCCGCGATTTGTCGACCTCGTCGCTGCTAGCCGCCCCCGCGCC
CTCGTCGTGCTTGCCTATTTCTTCGCCGCCGTCGTGCAGCTGTCGGGTGTCTGGTGGCTTGGTGAGGGTGCTGGTGCTGG
CCGCAACTGCATCGCCAGACGCGAGCTGCGCGGCATCCGCTCTGTCCTGCCCGACGAGTGGACGGGCCTCATGGTCTGGC
CGCTGGACATTGCCGGCCTGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62