GenePrediction:GLEAN_2967 Details

Name: GLEAN_2967
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:192313..194431 (+ strand)
Length: 2119
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:192313..192442 (+ strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_124:192495..192617 (+ strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_124:192680..192902 (+ strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_124:192976..193179 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_124:193235..193318 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_124:193377..193501 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_124:193570..193620 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_124:193677..193759 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_124:193826..194003 (+ strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_124:194082..194173 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_124:194249..194431 (+ strand)
Length: 183
>GLEAN_2967 class=GenePrediction position=GCSC_124:192313..194431 (+ strand)
ATGGAAAAGGTAAACGAAAAGGTCACTGAGACTACGCTCGCCCACGATAGCACAGGAGATGCTGGGCTTGCCGAGAGCGG
ACCAGACAATCGAGAGTCCAAGCGAACGTGGCGAACATATCTGTGGCCCAGTAAGGCGAGACTCGTCCAATCGTGAGAGA
GCCTGCCGTTCTGACGTCCCAGGCCTTGATCTTCCACGCGACGAGGCTTATTTTCTCACCAAGCTGGACCTTACCCTCAT
CTCGGCATCTGCTCTTGGCGTCATGTGTCGTTATCTCGACCAGGTCAACATTACTAATGCCTTCAGTGCGTAGCCCTTCT
CTCTCGAAGCAGAGGCTGGCCGAGAATGCATATTGACCGTCCTGTAGACAGCGGCATGAAAGAAGACCTCGGACTCTACG
GTAACGAGCTCAACTACGCCAATGCCGTGTGGAGTGCAGCCTACGTCTTCGGCCAGATCCCGTCCAACCTGTTGCTGGCC
CGAGTCAACGCCCCGCTCTACATTGCCTTTCTCGAGCTGTCTTGGAGTGTCTTCACCTTTGCCCACGCCGGAATCCACAG
CATCCGCCAGCTCTATGTCTTTCGATTCTTGTGAGCTTGTCCAACCGAATCTTTCAACCGAATCTTTTCGCTACTTGAAA
AGGTGTCTGACCCTCCCTCCCAGCGTCGGCTTGTTTGAAGCCGGCCACTTCCCTGCTGTCATGTACATCTGCTCCAGCTA
CTACAAGCCACACGAGCTCGCCCGCCGAAACACCATCATTCAGGTCTTCACCTCTGTCGGCCCGCTCTTCTCTGGCTTAT
TCATGGCTGCCGTGTACAGCGGCCTCGATGGGACTAACGGTCTGGCTGGCTGGCGATGGATGTACATGTGAGTGCCGCAA
TGTAATCAAGTAGCATTCTCCCATGTTCGCTGACTTAATAAGCATTTGCGGTTGCATCTCTGTGCTCTGTGCCATATGGA
CCGCCTTCGCCATGCCCCAGCTTCCCAACCGAGCAAAGGCCAACTGGTACGTTTTCATGGTTGGCCCCAATCCCCTTTTC
CCCCGCTGACATTGATGCTCCTAGGATCTTCACCGAGGCTAACATCAGATTGGCTCGTGCCCGCATGCCCTCCGAGGCCA
AGATGCTTACCGGCCTCTTCAAATGGAAGGACATCAAACGGTGGCACACAACGTGGCACGTGTATTTATGTAAGCCATCG
ACAGTCTCGTAATCTGTCAGCCCTGTTAGGTACCAAATCTTACTACTCGTCTACCAGTCCCCCTGCTGTTCACCATTATA
ACTCAGTTTGGCCAGGCTGGTGGTTCAAGTAAGCAGCCATTTCCGTTTTCGCACTTGCCGTCCTCTCTCTGCTAACCAGC
ACAGTGATATTCTGGGTCAAGAGCTACAATGTAAAGGGAGAGCCGGTCGTTTTTTCGGTTGCCGATATCAACATAATTCC
TCTCGGGGTATGTAAGCATGAAAAACAGTAGCATGTGCGTACCATCTAACCAAGGGACTGACAATCCCACCAGATCAACT
TCCTCGCCATCTTCTGCGCCCTCATTAACGCCTGGGTATCCGACAATCTTCCTGGCTCTGCCCGCTGGCCCGGCATACTT
TTCTCCTGTATCATGGCTATCATCTTCCCTGTCGCCCTCGCATCCACGCCGGTCCATCCACCGAACAAAGGTACCCGTTG
GGCGCTGTACTGTATGTCTCTCTATCTCACTCTGTGTGTTTGCTCTTACTAACCACCGACCCAATATACTCTTCTATCAG
ACCTGACAGCGCTCATCAGTACTGGTGCAGGAATCACCTGGACGTATGTCAACGGGATCAACAGGCACGATCAGGAAAAG
CGGGCATATGTATCAGCGATGGTAAGTCCCCAGGATTTACTCGATATCCGCCACCCATCTCCAAATTTATGTCTGACCAC
ATACCTGCCCATTAAGATGAACGCGTTCGCCTATATATTCACTGCTTGGGTACCTATCTTCACCTTTCCGACTAACAAGC
AGCCGTACATTGTCGCCGGAAACTACATCACAGCTGGCTTTGGCGCGGCAGCTGGGCTGGTGGTGCTGGCCATCCGCCAC
TTTGACCTTCGGGATCGCAGACGACAGCAGAGGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62