GenePrediction:GLEAN_2968 Details

Name: GLEAN_2968
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:204845..206607 (+ strand)
Length: 1763
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:204845..205822 (+ strand)
Length: 978
Type: CDS
Source: GLEAN
Position: GCSC_124:205891..206607 (+ strand)
Length: 717
>GLEAN_2968 class=GenePrediction position=GCSC_124:204845..206607 (+ strand)
ATGGACAAGCTCAGCGTAGAGATAGTGGAGCATATTGCGTCGTATATGGATGCGGGCTCGGTGATGGCACTGATGGCGAC
GTGCCGAGCGATGCGCAAGCCGTGCGTATCACGGCTGAGCCCGGAGCGCTACCTGCAAAAGACGTTCCGCCAGGCGTCGT
CACTGCTGGCGGCAATGGCAGACCACGGCTGCGTGCTGTCGGGCTCGCGGGCACTGGATTACTTTGTGCCGGGATCGACT
GGGGAGGCGAGCAAGTCGGACGAGGGCGAGGAGCTATCGGACTGGGACTTTCTGGTTCCGTGCGTGGAAGGTAGCGTATT
GGGGATGATGGAGGCGTTGGCAGCGTGCGGAGTGGACTGGGGCGACCACCGACTGTCGGAGCTGATGGCGCTGCCCACTC
GGCGCCTGGGAACGACGGCAGTGGTGTCGGCGACCACGGCGCAGCGGCTGCTGAACCAGCCGTACAGCGAGCAGATGCGG
TCGATGGACGAGATCGTGGAGCGACTGCGGCAGTGCGGAACGCTGGGAGAGACGGAAGAGCTGCCGGCCGAGGCAGAGCG
GATGCTGCGAGGACTGCACGCGTTTGTGAATGAGATGATTCACGCCGAGTTTGCGGGGGTGACGGTGCAACAGACGCTGG
CAGAAACGACGGGCGGCCAGACGCGGTTCCGGTTCGACAAGGTGCAGCGCAAGAGCAGCAACAGCAGCCTGGGCCTTCTC
GGCGAGTACGGCGGCTACGACATGAACTCGTACGGGTCCATGTACGGGATGCCGGGGGCCAACGCGAACCAGCCAAACGC
GATACACCTGGTCAACTGCAGCATAATGACGAGTCGGACGGGACGACGGGCCAAGGTGCAGCTGTTTCAGTGCCACAACA
TCGCCTCGGCCTCGACGTCACAGTACAGCAGCAGTCTGCGGCATTTCCGGGCGACGACGCCGCTGACCTACGTGCTGGAC
GGCTACTATGCATCCCACGTGCAGTGCTTCATCGGCGGCTTCTGTGCCGGCCACTTCTACTACACGCTGGCCCGCGAGCT
AACCAGGCGGTTGTGTGGCCCTTTTCCGAGGCGCAGGCGCCGGCCGTCACCAAGGCCGTGGCCAAGTACCGCCAGCGCGG
CTTCCACTTCCGCCATAGCGGCCTGCTGGACCTCGAGGTCAACAGCCGCATGTCAACGGCGTTTTCGCCCGAAGCCTCGG
ACTCGGCTGTCGGTCGTGTCGTCCTCGAGCTCGTCGCCGAGGCCAAGGCCGCCCATCATCTCGGCCAGCCCGGCACGCTG
CTCGTGCGCTTCCGCCGTCTCGAAGACCGCCTCGCCCAGCAGGTGCGCGCGCCGCCTGACGTCCTGTCGGCCGGTCGCCT
CGTCCATGGCCTCTATCGCCATCTGCGCGATGCGGTTCTTCGCTTCCGCTTCGACTTTATCTCTGGTCGTCCCGTCGCCG
CCGAGCCCGTCATGCCGCTGTTCTCCGACAGCTATGGCACCAGCCACATCAGCTCCGCTCACAGCCGCTTCCTCGTCCAC
AGCGACCCGCCCTTATCACCCTACTCGCCATCAGCCGGTTTCGTCCGCCCCATTAGCGCCTCGCGGCTGCTGCCGGCTCT
CGCTGTCGCCGACGCTGTTCCCCCGGCCATCCCGCCCGTCGGCGTGCTCACGCCCGGCGACCCCGACTGGACCCGCTGGA
AGTCCATCCTGTCACTCGCCCCCATGTCCTGCCACTTGACTAGCTGCGAGCGCCATCTCAAGCACAAGCCGCCGCAGATT
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62