GenePrediction:GLEAN_296 Details

Name: GLEAN_296
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:857209..861851 (+ strand)
Length: 4643
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:857209..857941 (+ strand)
Length: 733
Type: CDS
Source: GLEAN
Position: GCSC_167:858012..859277 (+ strand)
Length: 1266
Type: CDS
Source: GLEAN
Position: GCSC_167:859392..860815 (+ strand)
Length: 1424
Type: CDS
Source: GLEAN
Position: GCSC_167:861215..861354 (+ strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_167:861413..861851 (+ strand)
Length: 439
>GLEAN_296 class=GenePrediction position=GCSC_167:857209..861851 (+ strand)
ATGGCACCGATAACCGTAGGTGGTGTGGCGCCGGTGGACCGGATCAGCGCGCCGTCGTCGAAGCAGTCGATTGAAGAGGT
GTGCTTCTCGGCAGCGCTGATCTGCCTGGACGGGCACTTTAGCGACCAGCCGTCGATCCCGGGGCGGCTGACGCAGGCCA
GGGTGGCCGGCATGGTCGCCCGCACGCTGGAAAAGACGCACGCACGCAAGGACGTGCGCGAGTCGCTGGCTCGCAACGTG
GAGATCTGGGTGTATCTGACACGCATCTTCAACAACGCGCTCGACAGCCTGACAGCCCGGTCGATCGGTGCTTTCGGCCA
CGTGGACAAGCCGGCAGGCGGCCCCGATGGCAGCGGTGGCAGTCTTGTCAATGGCAGCGTCAACGGCAGCGTCAACGGTT
TCGCAGCCAACGGACACGGTCACACAGCAGCCCACCACATGCACGCACAGGGCGGGCCCGGGTCGGTGGCCCACGACAGC
ACGGAGCTGATCGTCAAGAACCACGCCGGCCTCAAGGAAGACCTGCAGATCCTTAACAAGCTGATGCACATTGCGCGGAA
CCTGCTCGTGTGTGCGCGACCGGAGGTGCCCCAGGACATCTGCGCGGCCGTCAGCTTCGACGCGGTCGTCTTCCAGGTAG
TCGTGCTGTGCGTCAACCTGGCCAGCAAGGGCTACAACAGCGAGCTGCTGGACGACCTGAGCCGTGGAAAGTTGAACGAG
GTCCACGATCTGTGTACGTATCTGTCCCCCGTCGGACTGTTGCCTGTCCAGCAAGTGATCCACGACTGACGGTGTATTTC
TAGACAAAAAACTGCTGGTCACTTCGCTGCAGCAGGTGCATAACTGGACGGCCAAGAACGACCGGAATAAGATGACGTTC
TGGAACTACGTGCTCTTCGAGGACGAGACACTACAGGACGACCTAGACAGCCTGGGAGGCGACGGCAGCGGGTTTCGGAT
CGACGTGGCCAAGACGGAGGTGAGGAACTGGCTGGTGCGCAACGGGACGGTGTGCGACGAGGCCAAGCGGGGGCTGGTGG
AGTACGCGGACTCGCACCAGAGCAAGGCGCCGGGAATCCCGCTGCTGGCCACGCCGCTGGCGCGGATCTGGATTCCGGCC
GAGCTGCTAGGGCCGCTTGAGGGGCCAGAGGCGGGCAAGTACGCACAGGACGAAGCGCTGGGACGGGTGTCACACGAGGT
GGACATGTGGTGGGAGCGGGTGTGCGATCCTAACCACGAGGCGTGGAAGGCTCCCATGTCGGATAAGGAGTACGGACGGC
GCCGGCAGGTGTACTTTGCCGAGATCGTGGAGGAGCGGTTTGGGCCACGGTGGCGGGTGCGCGACGAGAACGAGGCGCAG
GGGTACACGTTCTCGGTCGGTGACGAGGAAGAGGAGGACGAGGAAGGCGAAGAGGACGAAGAAGACGAGGATGAGGACGA
CGACGAGGACGAAGACGGGGAGACTGGCAGCGGCAACAACCCGAGGCAGCAAGTCGGGGCGCACGAGGGAGAGAGAAGAC
CGTTGGAGGAAGTGGAAGACGACGAGGAAGACGAAGAGGACGACGAGGGACGGGACGAGCGAGACGATCGGGAGGTGGAC
GACCAGCGGTACATTGACGAGGAGGACGAGGAAGAGGACGACCTGGATGACAACGACTCGTATGGCGACGACCCGACGCT
GGGGCTGTTGACGGAGATCCCGAACATCCTGGACCCGAAGCAGATCGAAGCGCTGCACATGATTGTCAAGTCATGCATCC
TGGACACGATGGGTAGTGGGCGGACAGCAACGGGCGAGAGCCTACAGCAGGCGCGATGCAAGATGCTTCTGGCGTGTGAG
AGTGGGCGCAGCCTGCTGCGGGAGATGCTAGTGTTCATCGCGGTGTGGGACCAAGAAGAGAGCTCGCTGATCTGGGACAT
CACGGCGCAGATCCTAGAAGCGCTACACGACGTGGCGCTTCTGCCGTACGCGTGGCAGGAGCTGCGGATTCCCAAGGATG
TGGTGTCGCCAGCGCAGGCGGTGATGCTGCGACTGGTGACATACATGTTGCGGAAGCGATATCTGGCGGGTGGGGGGCGA
CAGGGAGCAGCTGTGGTGACGACGGGAGGCGCAGCTTCGACGGTGGCGACGACGACGACGACTACGACAACAACGACTGT
GGCTGCGGCTGCGACAGCAGCAGCAAGCTCACCATCGCTGGAGAGCAACGATCTCAAGCTGGTGCACTACCTGTTCAGCA
CGGTGCGATGCCGGATTGTGCCAGAGTGTTTGGCGTTTATGACGCTGCAGGGAGAGATTCGACGAGGAATCACAGACGCG
GCAGACTTCCCGGTAGAGAACTGGGACATGGAGCGAGCACGCGACGGGCTCAGCCAGGTGCTGGAGTTCCTGGCGACGGT
GTCGGAGATTGACGCTCTGCGCGAGAAGATGGTGGAGTGGGAAGCGTCATTTGAGATCATCTCACTGCTGAAGGGACTGG
AAGACGCAGTGCCCAAGAAGCCGCTGGTCGAGGCACCGACACGGGCTGGAGCTCGGGGAACAGCTGCACCGAGACAGCAG
AACCAGGGGCAGAATCAAAACCAACAGCAACAGCAGCAGCAGCAGCAGCAGCAGCATCCACCACCACCGCCACCACCACC
ACCACCACCGCCGCCTCCACCCATTCCGCAGGACCCGGCTCACAAGTTTCCGTGGGCCGGCATCAAGACGCAGACGTTGA
CGATCCTGGCCAACCTGCTGCAGCCGGCGCCAGGAAGGACGACGCCTGGCAACGCACGGGTGCAGAGCCAGGTGATGGGC
GAGAAGGGCATGGTTCCGCTTCTGAACGCGTGTGTGTACGATGACCACAACCGGTTTGCGCGCGAGCGCGTGCAGATGTG
TCTCAAGTTCCTCATGGATGGGTGCGAGGAAGCCAACATGTTTGTGCGCGAGCTGGTCAAGACGGCGCCGCCTCAGACGG
CCGGAGGAACCGGAGCAGGAGGAGTCGGAGGAGTCGGAGGAGCCGAAGGAGCAGGGAGTGGAGGGGCGGCCGGTGGAGCA
TTGCCGCCGGCCAGTGCAGCCTCGAGTGTGTCTGATGACAATATGAGCACATTTACGACTTTGCGAGTGGACGGCATCGA
GGGTGAGGTCAAGGTGCAGGTGCGGTCGCCGTCGGGGCCTTCCGAGCCGCCAGCATCAATGACGAGTGCAACCGCGACGA
CTCTCCCGTCCGTGTCGTCTTCTTCGGCTGTGCCTCGAGCAGCCAAGCCGACAGTTCTGGCACCACCAACGCCGACACCC
GCGATGTCTCCAACAAGCACAGCCACAGCCACAAGCACAGCCATAGCCACAGCCACAGCTACAGCTACAGCTACAACAAC
GCTGGCCACGGCGCCAAATCCGCCTCTGGGCACGGCTCGACAGCGGAAGCAGCGCCAGAAACGCCAGCAACGCCAGCAGC
GCCAGAAGCTTCAAGAAGCTCTGGAGGCTCAGGAGCAGGTGCAGCCGCAGGAGTCTACAAGTGGTGGTAGTAGTGGTTCT
GCTGCTGTTAGTGCCAGCACCAGTGCAACAGGACAAACTCAGGCACCACCTCACACGCCGCCATCTCAGCCACACGCACA
GCCACAGGTACAGACGACAACGACGCCACCTGTGGCGCCCCGCGTTTTTGGCCCCCCGCCGCCGCCGCCGCCGGCACCCT
CGCTGGCATCGCTGGTCGCCCACCTGCCGCAGCTGCCGCCTCTGTCGGGCCACCATCTGGGGACGACGGGGATCAGCGGA
CTGGGCGGACTGGGTGGGCTCGGCGCCCTTGGCGGGTTCGGTGGCCTCGGCAGCCACGGCAGCGTCAACGTTGGTTCTGC
TGGCAACGGCACGTTCAACCTGCAGCAGCAGCTTCATCATCATCTGCAGCAGGCAGCCGCAGCCGCGGCCGGACTCGAGG
CCTCTCCTGGACATGCACAGCCGCAGCAGCCAGGAGGTCAACAGCAACAAGGTCAACAGCAACAGCAACAGCCCATGTCG
GCCAAGACAGCCGAAGCTCTGGCCGCTCGACGGACGCGCTGCGAGGCTCTGCTGGGCGAGATCATTTCGCTGTCAGACCA
CACGGCCCGCATGGCCCTGTCGATTGAGCGCGGCGAGATGCCACCACTGCCAGATGATGCTCTGATGTAAGTGTCTTTTT
TTTTTATTTTTTTTTATTTTTTATCATTTTCGCTGACAAATCAGGAACTTTCTCAAGAGCCAGAAATTCCTCGAACGCTG
CCGGGACCGGCTGACCCCCCTCAACGGAAGCGCCGGTCCAGCAAATGGTCCGGCCGGTGCTGCAGCTGCTTCGACCGGTT
CGTCGGCATCATCAGCCGCTGCTGCTGCCGCTGCCGCCGATGCTGCCGCCAGCCTGGACGCCTTCGGCTTCGACCCGGCC
GCGATACTCAACGACCCGCTGGCAAGCCTGTTTGGCGGTCTCGGCCCGCTGCCCAATATGGTTGCCGGTGCTGCCGCTCC
GCCCGGTGCCAACGGTCCCGGTGGGCCCTCGTCGTCATCGTCGTCGTCTGTGGCCGCCATGGCCACCTCGCTCGAGGACC
AGTACCGGCTGGTCGAGCAGGCGCTGCTGTATCTGACGGAAGACCTGGCCAAGAACTCGGAGCTGGCCAGTCTGGTGCGG
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62