GenePrediction:GLEAN_2970 Details

Name: GLEAN_2970
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:215229..216554 (+ strand)
Length: 1326
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:215229..215252 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_124:215329..215564 (+ strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_124:215627..216554 (+ strand)
Length: 928
>GLEAN_2970 class=GenePrediction position=GCSC_124:215229..216554 (+ strand)
ATGGTCCTCTTCTGGCCATGGAAGGTACGTGATGTGCACACGCCAGCCTGCGGGCATCGTGCTGCCCCCATGTGCCTGAC
GGTCGCTGACCAGTCGTCAGGGGGTCGATGCCTCGCCGGCGTCGTTTGAGAAGGCGCTCGCAGGACTGGCCGCCAAGATC
TCCGACACCCAGGCCAAGCTCGACCACACCCGGTCAGCCGCGAGACGGGTCCGTGTGCTCGCGACGCTGTACCTCTCGTT
TGCCTACGTGGTGTACGCCATCGTACTCGTCCTGGTCGTCGGCTATCGAAACTTGGGCGCGCTGGAGTGGTCGGGCATCG
CTGGAGGTCCGCTCGCGTGAGTGTGCTGCCCTACTGCCCCTGTGCTCTGTCTGCTGCTAACCGGATCTCTGTCGACAGCA
TTTACACCGTCCGCACGGTCCTCGACGCCTACTTCAACTTCCGCATCGATATGCTCACTGCTCGACTCAAGGACTTCAAG
GCCGAGCGCGAAAAGACGATCCTGAAGCTCAAGGCTGCCACCAAGTACGACTCCACCCTCGAGCTGTTGGAGAAGTACGG
CGGCGTCGAGACCAAGCAGGGCGACCACAAGAACAAGGGCAGGCCGCGGCTGGCCCATGTCGACGACAGCCATGCCCACC
CGTCTTCGTCGATCCGCACCGGCTTAAAGCCCCCAGCAACTGCCAACATCGCCCGCGGCACACCGCCGCCGCCGCCAGTC
ATCTCCATCCGTCCGAGTCCCGATGCTCCCGATGCAGCTTCTGGTTCCGATCTGGACGTGTCGGCTGAATTTGCGCCCAA
CGCCTTTGGGCCCGATACCGAAGACCATATGCTGCTGCTGCAGCAGCTGGGGTCCCGTCCGGCCTCGGCCATTTCCAGGC
CGGCTACTGCCAACACCAGGCCGGGCACGGCCACGTCGGTTGCCACCACCGCTCTCGCGCCGCCTGCCACCATGACCGTT
GCCGCCGCCGCCCATCCGCACTGGTATGACCGGCTGCTGGACCTCCTGATGGGCGAGGACGAGATGGCCGCCAAGAACCG
TATCGTGCTCGTCTGTGGCCGCTGCCGGCTGGTCAACGGACAGGCGCCGCCGGGCACGCGCAGCCTGGCTGAACTGGGCA
AGTGGCGGTGCATGGGCTGCGGCGCTGCAAATGGCGAGGTGGCCGAGACGAAGCCGTCTCTCGGCGACGTATTGGAAAAG
CGACAGCGCCTCCGACCCCAGCGGGCGTCCAGCAGGCCACCGGAACTCTCGGACTGTGGAAGCGAGCTGGAACCAGACGA
GGCCGAGGACACCGACTCCGAGGCCGACAGAAAAACGCATTCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62