GenePrediction:GLEAN_2973 Details

Name: GLEAN_2973
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:234907..235948 (+ strand)
Length: 1042
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:234907..235142 (+ strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_124:235198..235273 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_124:235331..235948 (+ strand)
Length: 618
>GLEAN_2973 class=GenePrediction position=GCSC_124:234907..235948 (+ strand)
ATGGCTTCTGACGTGCGTCGACCACAAGCCCCGCCGTCTGCGGGCGGCTTCGAGGACTACCTTCCTGACGACCTGGCCGA
CTATGGCAGCCTGTTTGGCGACGAGCAAGACGGGGCCGACAAGTCTGGCAAGTCCAAAAAGGCGGGCGGCGATGTAACTG
CCGGCCTGGGCATCGACGAGGAGGTCGACGTAAAGAAGCGCGCCCGAGAACCGCGCGTGAAGCTGGACGAGACTCGGTGT
GTATCTGCGGTAACTCTCGCCACCCTTGCGCCTTTATGCTGACGGCACAAGGATCCTTTCTGCCAAAGGCATCCCGGCTC
TGCGACAGCGTGCGAGGAACCTCAAACTGAAGGGCAAGGGCCACGAGGTGGGTTTTTCTTCCCGACTACTCTGCGCCTAT
ATCGGCTGACAAGCGGACCTGCAGTTCGCCGACGCCTCTCGACTGCTGTCCATGTACCAGCTGTGGTTGGACGACCTGTT
TCCCAAGGCACGCTTTGGGGATGCCCTTGCCATGGTCGAAAAGGAAGGCCACAAAGCGAGCATGCACAAGATGAGAATGG
AGTGGATAAACGAGTCGAAGCCGCGCGACCATGGTGACTCTGACGCGGAGGGGCAGCCTGGCGAGCACGAAGATGCGCAG
CCAGCACAGCAGAGCGGACCACGGCCCAGTGTCCCAAGTCAGGGAGAGAAGGAACCGTTACAGCCACAAACACAAACACA
AACACAACCACAACCACAGGCAGCACCACAGCCACAACCGCAACCACGACCACGGCAGACCGGTACAAGCAGCGGCGACC
CAATGGAAGAAGATTTGCTAGACGAGGACCTATACGGAGCCTCTCCTGTGCGGCCTTCACGGAGGCATGAAGCAGACGAG
GTGCCTGATGAGGACGAGCTGGACGCCCTCATGGCCGAGGCGGCTGAGGCGCACGAGCAACCACCTGCTCAGCCACCTGT
ACCCACCCAAACGGCCATGGACGACATGGGCGACATGGACGAGCTAGATGCCCTCATGGCGGAAGCAGAAGCAGCATCAT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62