GenePrediction:GLEAN_2974 Details

Name: GLEAN_2974
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:236222..240328 (+ strand)
Length: 4107
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:236222..236403 (+ strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_124:236466..239574 (+ strand)
Length: 3109
Type: CDS
Source: GLEAN
Position: GCSC_124:239639..240328 (+ strand)
Length: 690
>GLEAN_2974 class=GenePrediction position=GCSC_124:236222..240328 (+ strand)
ATGGAGGCAATACATGCGCGTGCCGAGGATGCCTCGTTCAGCAACATCGACTCGCTACTGTTTGCGCGCCGGCCACGGAA
ACGCAGGCCGCCGGCAGCAACAGAGGTGAAGGCGCGGCTGGAGAAGACACTGCTGCAACCACCGCAAGCGCTTCCGCTCA
AGATTGTCGAGCGTGTTCAACAGTGCGTACTTTTGTGTTTTGAACCAGCGTCCGTGTTTTACGCATATGTACTGACCTTT
GCAGGCGCTGGGATATTCAGGTGGACAAGACGCTTCTGTTTGAGATTGACCCGCCAGACATTGGCACGCAGACCATCTTC
TATCGCGGAGGACGGAACTTCCAGATTGTCGACTATGAGGAAATAGCAGCACCTCGAGAAGTTGGCGGTGCAGACGCACA
GATGGGCCTCGGAGGTGGTGACGGCAGCAGCATTGTGGCGTCTCTGCCCCTTTCCGGGGTAGGTAATGTGGCAGAGTCAG
CAGCCGATGCAGAGGAGCAGTGGCTTCAGCAGACGGTTTTTGCGAGCGACGCAGCAGCAAAGGCCAAGGAGCGAGCGGCG
GCAGCCAGCGCAGCCAATCTGCAGCGAGTGGTTCAGCCGGCGACCGGAGGACTGTTGGCGGCGGCGCCAGGGTTCGAGCG
GGGGATCCAGTTTCAAAAGAAGAAGCGAGCTGGCAAAGAGGGCAAGAAGAAGACAGGATCACGGCTGTCAGGCGAGACGG
GCGAGGAGGAGGACGCGGTGCAAGAAGAGGCCCGGAGAGTGCGAGAAGATCTGGCCGCAGATGAGGAGTCGGAAGCAGAC
AACGACGACGAGAAGGTGAAAGTCGGAGATGGGAACCGAGAGGAGGAGGAGGAGCGTACGGGCGAAGACGACGACGACGC
AGACGAAGACGAAGACGAGCACGGTGACATGGCGGTGGACGAGCTGCTGCCAGTGGAATTTCCGTCGCTGCAGCCAAGCG
GAGCAGCTCTCGGGCCCAAGAAGGAGCGGCGCGAATGGGCACACATGGTGGACCTGTCGAAAGGGTCGGTCAATTTTGCC
AGCCTGGCCGGAGGTGCAGACATGGCGCGAACGTGGCCGTTTGAGCTGGACGCTTTCCAGAAGGAGGCAATCTACCACCT
GGAGTGCGGAGACTCGGTGTTCGTGGCGGCACACACGTCGGCAGGCAAGACGGTAGTGGCCGAGTACGCGATCGCGCTGG
CGCAGAAGCATCAGACAAAGGCAATCTACACGTCACCGATCAAGGCGCTGAGCAATCAGAAGTTCCGGGACTTCAAGCAC
GAGTTTGAGGACGTGGGGATCCTGACGGGCGACGTGCAAATCAACCCGGAGGCCAAGTGCCTGATCATGACGACAGAGAT
CCTGCGTAGCAAGCTGTACGGCCAGGCAGACTTGCTGCGCGAGGTAGAATTTGTGATTTTCGACGAGGTGCACTACGTCA
GCGACACGGAGCGCGGCGTGGTGTGGGAAGAGGTGATCATCATGCTGCCGGAGCATGTGTCGCTGATCCTGTTGTCGGCG
ACGGTGCCCAACACGTATGAGTTTGCATCGTGGGTGGGCCGGACGAAGCGGCGGGATGTGTACGTGATTTCGACGCCGAA
ACGGCCGGTGCCGCTGGAGCACTTCCTGTGGAGCGGCAAGGGGGTGCAGAAGATTGTAAGCGCAGACCGCAAGTGGCAGG
AGACGGGATACCGGGAGGCGGTGGTGGCGAGCAGTCCGAAGACGGTGGCGGCTAGCACAGGTGGTGGCAGAGGAGGAGTA
GCCGTCCGGGGAGGTCCTGGAGGTCGAGGAGGGCCAGGTGGCCGGGGAGGACCGGGTGGCCGAGGAGGAGGAGCCGGTGG
CCGAGGAGGCACAGGCCGTGGTGGCGGTGGCCGAGTTGGACCGCCCCGAGCTTCGCATATGCCCGGACACATGGGCCGGA
CTAGCGGAACAGCATCGCTGGCACAGGACAAGACGCTCTGGGCGGACGTGGTGCGGTACCTGCGCAAGGCAACGCTGCTG
CCGGCGTGCATCTTTGTGTTCTCGCGGGCGCGATGCGAGGAGTTTGCACAGTCGCTGGGGACGCTGGACTTTTGCGACGC
GGGCGAGAAGACACGGATCCACGCACTCTACTCACGCAGCATTGCGCGGCTGGCACGCGAGGATCAGGAGCTGCCGCAGA
TTGCACGGCTACGCGACCTGGCAACACGCGGCATCGCGGTACATCACGGCGGGCTGCTGCCGATCGCCAAGGAGATCGTG
GAGCTGCTGTTTGCGCAGTCGCTGGTCAAGGTGCTCTTTGCGACGGAAACGTTTGCTGTGGGACTCAACCTGCCGACACG
AACGGTTGTCTTTTCGGACCACCGGAAATTTGACGGGACGCGGCGGCGGGTGCTGTCGCCGGGTGAATACACGCAGATGG
CCGGTCGGGCTGGCCGTCGCGGGCTCGACAGCGTGGGCACGGCGATCCTGGTGCCGGCCGGCGAAGCACGCGAGATTCCG
CCGGCCGAGACGCTGCGCAGCCTGATCCTGGGGCAGCCCACACGGCTGACGTCACAGTTCCGGCTAACATACAACATGAT
CCTCAGTCTACACCGCGTCGAGACGCTGCGAGTCGAGGACATGATGAAGCGGTCCTTTTCCGAGAACGCAGTGCAGAGCC
GGCGGCCAGAGCATGAAGAGCAGGTGCGGACTCTCGAGGCCGAGCTGGCCGGGCTGATACGGAAAAGGCCGGCATGCGAC
GTTTGTGACGGCAGCAGCAGCGACGGCAGCACGGCCAAGCGACCGATGACGACGTGTCACCAGGCGGCCCAGACGTTCCG
GCAGGACTCAGCCCAGATGTACGACAAGCTGGCCCGGCTGTCTCACGGCAATCCCTCCGTCTTTGGCCGCGGCCGGTTGG
TGGTCTTTTCGAATGAGACCGGTGTGCGGGCTGTTGGCGTGCTCGCCGAAGATCTGCGCATCCCGACCGACGCTGCGGCG
GCTGCCACGCCCTCTGTGCGCATCGTCGAGCTGCGGCCTCCGCGAGCGACGCCCGACGGCAGCGACTCCCTCGCGTTTGT
GCCAGCTCTGCGCTGCTTCCTACCGCCAGCACTTCCTACAGCAGCGCTTGTACGCATGGCCACAGTGCCGCTGGCCCGGA
TCGAGCATGTGGCCAACATGGTGCTACCGCTGGATGACGAGCCCGAGACAGCAGTGGCACGCCAGCTGGCAAGCGGCAAG
GTCGACCTGTCGTGGGACTCGGATGTGTGGGACGACGTGAACCTGGACCGCGTCCGTGACGTGGATATTGTCTGGTACCT
GGACGATCGAAGAGCCAAGGCGCAGATTGTGGCCGGCTCGGACGCGCTGGCATGTTCCGAGTTTGTAGAGCATGTGAGTG
TGGTGCTGCTTGTTTGCTTGTGTGTCGTTCTGTCGGTAACGTCTCTAACATGTTCAGTACGCTCTCCGTCACGAGGAATG
GACGGTACAGGACCACTTGGCAACGCTGCGCCGGTCGATGGACGACTCGACGCTGGCGCTGCTGCCGGAATACCAGAACC
GACTGGCCGTGCTCAAGCACCTTGGCTTTGTCAACAGCAGCGCGGTAGTGCTGCTCAAGGGCCGGGTGGCATGCGAGGTG
CGCACGGCAGACTCGCTGGTGCTGACCGAGACGATCCTCAACAACCTGCTGGCCGAGCTGGAGCCGGCGTCGATCGCAGC
GCTACTGTCAGTATTTGTGTACCAGGGCAAGGACGACACGGACCTAGAGGCGGCGCCAGTGATCAGCGCGGAGCTGACAC
GCGGATTGACGGAGGTGTACCGGATTCGCAAAGAGGTGGTGCGGACACAGGAGCAGTTCCACGTGTTGTCGGCGGGCGAC
GAGGTCGAGTCGGCATCGCGGCTGCACTTTGGGCTGATGGAAGTGGTGTACGAGTGGGCCAGCGGCAGCCCGTTCAAGAC
GATTGCCGGCATGACGACGGAGCAGGAGGGCACGATTGTGCGAACGATTACCCGGCTAGAGGAGACGTGTCGGGAAGTGC
GCAACATTGGGCGGATCATCGGCGACACGACGTTGGAGACAAAGATGAACGGGGTCAAGGAAGCGATCATGCGGAATATT
ACGACAGTACCAAGTTTGTATTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62