GenePrediction:GLEAN_2976 Details

Name: GLEAN_2976
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:246875..249514 (+ strand)
Length: 2640
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:246875..246893 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_124:247256..247628 (+ strand)
Length: 373
Type: CDS
Source: GLEAN
Position: GCSC_124:247764..248108 (+ strand)
Length: 345
Type: CDS
Source: GLEAN
Position: GCSC_124:248196..249215 (+ strand)
Length: 1020
Type: CDS
Source: GLEAN
Position: GCSC_124:249289..249514 (+ strand)
Length: 226
>GLEAN_2976 class=GenePrediction position=GCSC_124:246875..249514 (+ strand)
ATGGAAGAAGAGGACAGAGGTAGGGGAGGGGCTCCTGAAGGAATTGGCCGTCTGCCGAATACACGTCATGTCGCTGACCA
GCCGCAGATTCGACTGCCCAGTCGGAGATCGACCAGGACGAGGTGATGGAGGATGTGGACGACGCAGAAAACGACCGCGA
GGGAGAGGGGGACGAGGAGGACCAGCTGGACGAGGAGGCAGAGGCTGACGCTGAAGCGGACGCAGAAGCAGAAGCGGAAG
CAGAAGCAGAAGCGGAAGCAGAAGCAGAAGCGGAAGCAGAAGCAGAAGCGGAAGCAGAAGCAGACGCCGATGCAGACGCC
GAAATAGAAGCTGAAGCTGAAGGAGAAGGAGAAGCGGACAGAGAAGGCGAGACCGAGACAGGCGGCGGGTCGCCGGGCAA
AGAGACTGCTCGCAGCACAGATGCAGCCGACGGAACGGCTGTAGACTCAGCCGAGACGATAGCAGCGACGCGGCAGCGAA
CGGGCAGCGCGTCACCGGCATCGATGCAACGGGTGTGGGCCAGAGCAGTGGCAGCACGGGTGTACGACATTGTGCCGACG
ATGGCGGCACCGCAAGCGACGAGTATCAACGCGCTGGCTGTCACGCCAGACCTGCGTTTCATCATGACCGGCGGATCGGA
CGGCTATATTCGCAAGTACGACGGGCCAGGCACCATAAACGGCAAGCAGCTGCTGACCGTGGCCCAGCGACACCCGTTTG
TCGACAGCGTCGTCAAGGCCGGCATCCTGATGTCGTACTGGGAGAACGACGAGCCGCCGCCGGGTAGCAGCATTGGTGGT
GGCGGGAGCGGCAGCAATGGCGGCGGCCCTGGCGGCGGGTCTGGGATGACGGCCACAACGGCAGCAGTAGCAGCTGCTGC
AGCTCGCAGCGCGGCCGAGGATCACATCCTGTCGCCGGTCTACTCGCTGGCCGTGCACTCGCACGCTCTCTGGCTGCTGG
CCGGCACAGAAGGCGGCGGGATCAACCTGCAGAGCGTGCGGCACGACGAGGGAAAACGTATCACCAGCCTGCTGGGCCAT
AGCAATGCCGTCAGCGTGTTGCAGCTGGCGCCCGACGAACGGAGCGTGCTGAGCGGCAGTTGGGACAAGAACATTTTCGA
CTGGGATCTCAACACAGGTCACGTGCGTCGCCATTTCGACGGCACCGGCGGCCAAGTTTCAGCCATTGAGCTGCGCCCGG
CCAGCGGCGCGCCCATCCCGTCACAGGACGACCAGTCGGTGGCAGCAGCAGCGGCAGCAGCAGCGGCAGCAGCAGCGGCA
GCAGCAGTGGGCGTCGATTCTACCTTTTCGTCGTCCAACAGTCAGCCGCTGACTAATGGCGTCTCCGTGCGCGATGGCCC
GACCAGCGGGGAGATCAACGGAGAGACCGGCTTGGGCACGGCAGCCGGTGTAGGCGTAGGGCCATCAGCGAGCGGTGCAT
CAGCCACGATCAACGGCGACGACCCCATCCCCGATCACGAGTCGCTATTTGGCAGCCCGGTCGTACCGCTGTACGGCGGC
ATGGGCGAGAATTCGTTTGGCGACGACGACGGCGGCATGGTCACGGCTATCGACAGCTTTGAGCAGGACGTCGACATGGT
GTTGGACAGCAGCAACAACAACGAAGCTGCAGCAACCGACGCCTTTGGCGACTCTTTTGGCGCAGATACGGCCGCTTCTG
TTTCTGCTCTTTCAGCCTCTGCTGCAGCGCTACCCCTCGACGACGACCCGCCAGCTACAGATCCCATGGTTGACCAACCG
TCCACGCCAGCTGCTCTTCAGCAGCAGCTGTCGGCCCAGACCCACGGCCCCGACTTTGCCGACGCCCCGCTGCTCTCGTC
CTCGGCTGCTGAGCCGCCTGCATCGCAAACCGAGCCCAGCTCTCAGGCCACCCAGACCGCTGCCGACGCCACCCAGACGT
CCCTGATCAAGTCCGAGGCCGCCCTGCCGTCTCAGCACGGCTCTCCACCTCCCGTCTCCTCCCCCTCGGCTCTTGTCTAC
TCGTCCCAACCGCCTCCGGCCGAGTTCGATCCCACCCAGATCTCCGAGACCACATTTTTCTCTGCCAGCATCGACGGCAC
CATCCGCATCTGGGATCGTCGACAGAGCCTGCCTATCGCCCGCATCGGCAACCGTCCTGGCGTGCCGCCCTGGTGCATGG
GCGCCTGTTGGAGCCCCGATGGCAACCGCATCTACGCCGGACGTCGCAATGGCATCGTCGAGGAGTTCGACATCCATCGT
GCCCGCAGCTCCTGGAAGCCTGAGCGCTCTCTTCGCTTTCCTGCTGGTAGCGGGCCTGTCAGTGCTGTTCGCGCCATGGT
CAATGGCCGTCATCTTGTGTGGTGAGTGTGGTGTTTTTCTCTGTTTTTGTCTCTCTCTTCTTTCCTTCTTTCCCATTTTT
CCTAACCCCAACAGTGCCTCCCACGATATCCTCCGCCTCTACGACCTCAACGATGCCGCCTCTAAGACCTCCAGCGTCCC
CTTCCTCATCATCCCCGGACCTCCGCGCGCTGGCGTCATCTCCCACCTCTACATCGACCGCACTTCGCGCTACATGTTCT
CCACCGCCGGTACTCGTGGCTGGGAGGGCACAAGCACCGAGGCCCTGATCGGCTACGAGATCAATTCCGTCGTCGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62