GenePrediction:GLEAN_297 Details

Name: GLEAN_297
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:871251..874559 (+ strand)
Length: 3309
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:871251..872423 (+ strand)
Length: 1173
Type: CDS
Source: GLEAN
Position: GCSC_167:872486..873983 (+ strand)
Length: 1498
Type: CDS
Source: GLEAN
Position: GCSC_167:874041..874375 (+ strand)
Length: 335
Type: CDS
Source: GLEAN
Position: GCSC_167:874458..874559 (+ strand)
Length: 102
>GLEAN_297 class=GenePrediction position=GCSC_167:871251..874559 (+ strand)
ATGGACGGAGGCGGCAGCCAGAGTCTGAACACTTTCTCCAGCGGCAATTCCCAGCAACGTCGACGCCTCACCAAGCGACC
GCCTCAAGCCCGCTCGCAGTCGTCTTCCCTCAGCTTCGATGGTCGCACCCTCGACATCCAATCGCTCCAGAGCAAACACA
GCTCCACGAGTCTGAGGCGTGCTCCCAGTGCCCCGCAAACTCGCTCGTCCGTCTCGGCCAACGCGTCGTCGTCCAACAAC
TCCTCGCCTCGTCGTCTGCCCTCTGCCGCTCCGAGCGGCCTGCCGAAACCTGAACCCATTCTCGCCAGCGGCGACTTTCT
CGCGGCCGACCCCCAAGTCCAGTCGCCGCATTACCGATTTCCGTCTCTGCAGGGCGAGCAGGCCTACCAGGGCTATCAGA
GCTACCAGAACCCGAGCCAGGGACAGGCCCAGAGCCAGAGCCAGAGCCTCCTGAATCACCAGAACCACCAGAGCCTCCAA
AATCACTACATCCACATCCACAACCTCCACAACTACCAGAGCCCCCAGACCAACCTTCCCTCCACTGCCGCCGCGGCAAC
GGCCTCCGTTCCCTTCGTCGCTGCCAACAGCCACGGCGGTGCGCTCACCTCGTCGTCAGAAGACTTTATCGGCGCTCCGT
TTGACGGTGCTGCCATCCTCAACCGGATTGACGAGACTGCTGCTGCCCCTCTTCAGACTCAACTGTTGTCCTATCCAGCA
CCGCCCGCCCGCAGTGCGCCCTCCCCTCCTCGAGCCGCCCAATACCCCTTCCATCCAGCCATGGCCTCTCCGTCGGCCCA
GCAGCTCGGCAGCTTCACCTCCGCCTTTGCTGCTTCCAACCCCACCATCACCGCTACAACCACCACAACCGTCGTGTCTG
CTCCCGCCTCCGCCGCTGTTTCACCTGTCCCTTCCGCCGAGATGGCCGAGAAGATCCCGTCTGCACCCCAGATCAGCGCC
GCCAAGGTTCTCGAGTCTCAATCCCTGGCCTCCAAGCGCTACTCTGACGAGCCCAAAGATCTCAAGGCGCCCTCCATGCT
GCGGAAGAAATCCGGCTTCTCTGGCTTCATGACCAGTCTGGTCGGCTCGCCAAAGAAACCGCTCATCTCGGCTCCCGAGA
ACCCTGTTCACGTCACCCATGTTGGCTATGACAGCAACACAGGACAATTTACCGTGCGTATACATCCCCCCCTCCTTTTT
CACTGCTGCTGCTGCTCTTCTAACCTCTCGCATAGGGTCTGCCGAAGGAATGGCAGCGGCTGATCAGCGAGAGCGGCATT
ACCGAGAAAGAGCGCACACAGAATCCAGAGGCACTAATGCAGGTCATCACCTTCTACAAAGAGACGACGGAGAAGCCGCA
AGAGGACCAGGTCCTCGAGAAGTTCCACGATGCCCGGCCGGGTCTGCAACCCGTATTGCTGCCAACATCGCCGGCGTCAC
AGCAGCCTGGCGCGTCCCCGGGCTACATGGCTGCGCCGTCGCTCATCAGTCCGCCCGCCAGCCCCCGTTTCCCAATTGTC
AACCACCATGGCAGCTTCGAGAATCCACGCTCTCCACCACCCGTGCCCAAGACGCCTCTCGGAACCCCGATGAAAGACCT
CAACCTGGTGCCCAGCCGGCGAGCCCCGAAGCCGCCCGTGAGCTTACCCTCCCGATCTGCCCCGCATCCTCCGTTCTTGC
CCACCAAGGACTCCGGCATAGGGATGGTGCAGCCGCTGGACGAGTCCGGCGTGCCAAAGGAGAATGTTCCCATGCTTCCC
GAGGAGCACCGATCACGGTCTAGCTCTCGTGCCACTGCGTCTTTCGGCACGGCCAACAGTTCAGCCCAGGCCAGCGTCCA
GGCCAGCGTCCAGGCCAATGTCATTGCACAGGCAAACGCCTATCAACAACAGCTGATACAGCACCAGCAGGAGCAGGCCA
TGGCACAGGCACAGGCTGCTATGACCGGCCAATTGGGGCGCTCTGCAAGCAAGCGCCAGCCGCAGTCACCCGCAGGCCTC
GTACAACAACCAACGCCTCCCCATTCTCAGCACCACCAGCTCAATCGGTCACCGGATGCGAACGGCGTAGCGCGCTCACC
GCAGGCGCTATACCCAGCTCCGACATTCCAGCAGCAGCAGCAGCAGCTACAGCAGCATCAACAACAACAGCAGCAGCAGC
AGCTGGCAGAACAGCAGCAGCAGGCTCAACTGAAACTGCAGCAGGCTCAGCAACAGCAGTTGGCGAATGCACCAAAACCG
CGCCAACGGCCACGCGCAAACACAGGCGGCGATATCGTCTCCAGGTTGCGGCTGATCTGCTCAGAAGGAGACCCTCGCGA
CATCTACCGTGGCCTGTCAAAGGTTGGCCAGGGCGCATCGGGTGGCGTCTACACCGGCTTTGAGAGAGGCAGCAATCGCC
TTGTGGCCATCAAGCAGATGAACCTGGAGCAGCAGCCGAAGAAGGACCTAATCATCAATGAGATCCTCGTCATGAAGGAC
AGCTCCCACCCCAACATTGTAAACTTCATCGACAGCTACCTGAGCAGCGGCGAGCTGTGGGTGGTGATGGAGTATATGGA
GGGTGGCAGCTTGACCGACGTTGTCACCTTCAACATCATGACAGAGGGCCAGATTGCCTCTGTTTGCCGCGAGACCCTGA
GGGGCTTGCAGCACTTGCACTCTAAGGGTGTCATTCACCGTGACATCAAATCCGACAACATCCTTCTGTCCATGGAAGGC
AACATCAAGCTGAGTGCGTTTCCCCGACTGCCATCTTTCCTTGCTTCCATGTGCTGACCCCTCTTTGCAGCCGACTTCGG
CTTCTGTGCTACCATCAACGAAGCCCAGAACAAGCGGACAACCATGGTGGGCACGCCATACTGGATGGCACCCGAGGTGG
TCACGCGGAAGGAGTACGGCCGCAAAGTGGACATCTGGTCGCTAGGAATCATGGCCATCGAAATGATCGAAGGCGAGCCG
CCGTACCTGACAGAGTCACCTCTCCGAGCATTGTGGTTGATCGCTACCAACGGGACACCGGTGATCAAAGACGAACAGAA
CCTGTCGGAAGTTTTCCGCGATTTCCTCTACTTTGCCCTCAAGGTAGAACCAGACAAGCGGGCCAGCGCCCATGATTTAT
TACGGGTACGCACTTCATACTCCCTCTGTTTCTTTCCGCTTGTTCGTCTACTTTGCACCCGGATTGCTGACATTCGTCTT
CTCACAGCACGATTTCATGAAGCTTTGCGTAGATTTGAACCAGTTGTCTCCTCTCGTTCGGGCTGCTCGCGAGGCAAAGG
CCCTTGAGAAAGCCCGGAAAGGGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62