GenePrediction:GLEAN_298 Details

Name: GLEAN_298
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:884740..887052 (+ strand)
Length: 2313
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:884740..884940 (+ strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_167:885210..885810 (+ strand)
Length: 601
Type: CDS
Source: GLEAN
Position: GCSC_167:886856..887052 (+ strand)
Length: 197
>GLEAN_298 class=GenePrediction position=GCSC_167:884740..887052 (+ strand)
ATGTCTCTGACGGGAGGTCCTTGGAACCTTCAAGAGGCAATCACAGAGCAGCAGACAGTCACCCATAGAGCAGGACAACA
ATTGACTTTTGATGTCCAGAGACTACAGGATTTAAGCGGCGTCTCTACCCGATCGCGTGAAGCAACGGGCGATGACGCTG
CCACCTGCTGGCTACGGGTTATGGCGGGGACGACGGTAATTGTAAGATATGGATCTTCCTGTGCACAGAACAGCCTAGCT
AACATCTGAAAGAGACGGATCGAAGTAAAGAAGATGGCCCTTTCTAAACACGAGATACGCCTCGTCCCTCCAACACGAGC
AACGATTCTGTATTCCGACATGGACAACCAGCAAAACCAAAGCACTAGAACTAGCCGTACCGGGTCTCTGGGGCGCGAGC
CCTTGAATGTAGGAGCCTCTACGTTTTAATTCCTGCCCCTAGTATCATACGAAGACTCTAATAATCTTAGGGGACATCAC
GATTTCTCAAGCTCTGCTTTCATGGGCTGGGCGACTTGAAAGCCGCATCACAGACGTTTTTGAAGCTTGGCCTACGATGT
ACAACACAGGTCAAGCCGATAGGCCGGACGTCATCACACCCAGCTCTCGCAACATCATCGCATCAGCATCAGCAATGGGC
GAATACGGGACCCGCTAACGTTGTCGCACGGGCACAATCTTACCAGGTGGGATATCAGCCGGAGTTTCTGAACATGGCGG
GATATGCAGCCCCACAAGCATGGGACCCAGGCTCTTTGGAGAGCCGGTTTCAGTCTTCACCCGTGAATGCGTTGAAACGG
CGCGCCAGCCTAAGCCTATCATCTCAGGCTGGGCTGCGGAGCAGGCTACGAAGAGAGTCCTCTTCCTTTGAGTCAACTGA
TGCCACAATTCGTCGATCTGAAGCTGTGTCTCAAAGCCAGTCGCCCTTTTCCACCCAGCCTGAGGCCATGCACCATTCGC
AACCAGCGGCATATATGACCTCGGCGGCTGCTGTGTCAAAGCCCCCGCCGAGAAGAGAGCTGCCACAGTCCATCACTAGG
CATATTTCGCTAACCCCAAGCCAAACTGAAAGTTAGTGAACTGAGACAATCCACTCATATTCCATACAGCTACTGATCAG
AGGGACAGATGGTCCCGACGCTTTCAGTCAACCTGGCCGCTTAAGATTAGCAGACACAAAGGTGATATCTAACGTTGAGG
CCGAAGTGCAGACAGAGACACCAACTGCCGAGCCGGAAAAGGCCCTCCACGCTGGCCTGGATTTTCTCCAGGCTCTGGAA
ACCCTGCAAGATCAGATGGTGCAAGAATGTTTGGAGGCCACCCGTGCACTCGATCTGGAAGAAGAATGTGAAGCTAACTT
GGTGGCCCATTATGCCAGAGAATTTGGAGATCGATTTACCGATATGTGTATGAAGCAAGCCAGAGCCTTTCATGAGTACT
AAGAGCAGATAGACTTCTACTTGCGAATGCTGCCATGTATTTATTCCCAGCTAAAAGCTTTGACCGGAAAAGGGAGTGTA
CCAAAAGCAATGAGCTCTTGTTGCAAGCAACAAAGTCCAAGTAAGACACACCATCGACTGTCTATATTCGATTTCTTTCG
CGGTCGACCTGGGAAGCTTCTCGTTATGTTGCCAGATAGTAAAGCCCAGCATAATGACTGAGCTGTATTATCTTCTGATT
GTCTGAGGGCCGAATTTCATAAAGGGATATGATCTCTCTGGGGAGTAGTATTTATACCTTCTAGTTCGCCATCTTCAAGC
GTTCATCTAGACAAAGAAACTTTGTCGAAAGGCTTCTCTCACATACAGACTGCCAGCAAACCTGATACTTTCGACTTGAT
AAGCACCTCAATTTGCTCCCGTTCGGGAGATTGGCTTTACTGTTCTACCGCCTTGGTCCTACGTCGCCTCTTCCAGCAGA
TGAGCAGGTTCATAGACGAGTTCCCTTCCGATACTAAAGCTTCTAATACCAAGCAGCCAACTTTGGTCCCATCTCACAAT
TGAAATCTAGCTATACGTTCCGAAAGATCCATTTTGCAGCACCGCCCGTCAACGATCTACGCTGGGCTAAGCCAGTTACC
ACTAGCAAACGACACGCTGCAAACTAAAACTGCGAGTATCGTACATCAGCCTTGTGGGCGGCTACCCTACGCAGGTGACA
GCCATGGGAAAATTGGCGGGTGACGGGTCTCTGATGCACCACCCGGTCGCGAGCGGCAGCACGCTGGCGCCACTGGCCAA
GCGCGTCATTCTGCAGTCATCGACGTATCAGTGGATGTGGGACCGGATCGGACGAGTGGAGCAGACGGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62