GenePrediction:GLEAN_2996 Details

Name: GLEAN_2996
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:49225..50559 (+ strand)
Length: 1335
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:49225..49404 (+ strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_160:49473..49603 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_160:49671..49950 (+ strand)
Length: 280
Type: CDS
Source: GLEAN
Position: GCSC_160:50004..50113 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_160:50178..50559 (+ strand)
Length: 382
>GLEAN_2996 class=GenePrediction position=GCSC_160:49225..50559 (+ strand)
ATGTCTCCGTCTAGCTCACAAGAGGCAGCTTCGGTCAGCCTTTCGGACGAGGACCGCTATTTCAATTCCAACCCACCACC
GAAATGCCTAGACGAGCACATGACCTTGGTGAACAAGTTTCTTGACAGGCATGCCAAGGCGAACCGGCGCGTGGTTCTTG
TCACTTCTGGAGGCACCACGGTACGACACCACGGGCCCTCAATCGCATCTTGATCACCTCGCACCCCTACTGACGGGACC
CGTTCTAGGTGCCTCTTGAGAGGCAAACAGTACGCTTTATCGATAACTTTTCCGCCGGGACGCGTGGCGCCACCAGCGCC
GAGTACTTCTTGGACGACGAGGCCGACTATGCTGTGATTTTCCTGCACCGGCAGTTTAGGTAGGCTGTCCGCAGCCAGAT
CTTCCCCAAGTGCTTCAGTACCGGCTGACAGGCCTCCCGCTGTTAGCCTTCAGCCGTACAGCCGGCATTATTCGCATGCA
ACAGACGGGTTTTTGGATTTTTTGACAGAAGATGAGCATGGCATCCGGGCTCGCGACCAGGATGCTACCGCCTTGCTGTG
TGTCTTGCGCCGTTACCGTGCCGCTCGTGATCGCTTGTTGGCCCTGCCTTTCGTTACCATCACCGACTACTTATTCGAAT
TGCGGGCTATCAGCCGCGCTATGCACCGTGTCGGATCCAACGGCCTGCTCTACTTGGCCGCTGCCGTCTCCGACTTTTTC
CTTCCTGTTTGTCTTTCCGAACTGCTCTCGGTTGCCTCCTGGACACTGACGCTCTGCAGCCCGAGCGGATGTCCGAACAT
AAGATACAGAGCACCGACATTCAATTGGATTCGGAAAAGTCCGCGGTCCGGAATGAAGACGAGGAAGAGGCGTTCGACAA
CTTTGATTCGTATGTAGCCCCAACACAGTGGTACTCTCGGTAGTATGATGCAGTCGATCTAACTGCGGCACAGGTCTCCC
AACATCCCCAGAAGCAAGCGGCTCGTCATTGATCTAGACCCAGTCCCCAAGTTCCTTAAAAACCTCGTTGACAATTGGTC
ACCGCAGTGCATGGTTATCTCTTTCAAGCTGGAGACTGACCCACAACTGCTTATTGTCAAAGCAAAGGGTGCTTTGGACC
GGTACCAGCACAACCTTGTGATTGGCAACCTACTATCTACGCGCAAGCACGAGGTGGTGTTCGTGACCCCTGACGCCGTC
GATTGGCTCCGATTGAACGAGAAGGATCTCGCTGCCAACATCGAGATCGAGGGCCGTATTGTCCCTCAGGTTGTTTCTCT
CCATGACAAACACATCCAGCACGTGCAAAAGGCAAAAGCAGAGGGGGTCGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62