GenePrediction:GLEAN_2997 Details

Name: GLEAN_2997
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:61514..63127 (+ strand)
Length: 1614
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:61514..61633 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_160:62063..62466 (+ strand)
Length: 404
Type: CDS
Source: GLEAN
Position: GCSC_160:62581..63127 (+ strand)
Length: 547
>GLEAN_2997 class=GenePrediction position=GCSC_160:61514..63127 (+ strand)
ATGGAGTTCACCCACGCCTTCTTCGCTGGCGGCCAGCCCTTTCAGCAGCAGTTCATCGGAATCCCCCCGCTGACGCCGTC
CCACTCCAATTCTGAGGATTACAACAGGACATCTCCGCCGGTGAGTGTGGCACTTTTCTTGTCCTTGTGCGAATAGTCGA
TTTTTATCATGCTGCTTCTGCTTCTGGACGGACGGTGCGACTATTGAAGAAACCTTCCGAAACCTTCCGAAACGGCAGAT
GGCCCTGAGGTGAGAAGTCTCCCTCTTTTTGTACTACGGCTGGCTTCTGCTTCCTACGTCCTACACCGTACCCACTCCGC
GCATTAGGCCTTGCTTTGGAAGCAATTTGCAAGCAGCATGATCAGCTGCAAGGCGTTGTGCGGGCTACAATATTGCTGTC
AGCACGGCAGACGACCCACACGTGGCATGAAGAGATGATGCCAGTTGAGAGGGAGACTATGAACAAGAATGCGAATACAT
CCTGGCACACCTCGCCGTTTCCGGTTGCCGTCCGCTGATTGCATCCATTACTCATACGGTATTACATAGGAGGGATTTCC
GGATTTCCCTAACGACCAATTCCAACACTTCGACGGCTACGCTGCTCAATTTGCCACTCAACCGGACGTTTTCCCCGGTC
CTCCAACTCCGCCGGATCAACATCAGCTTTCAGGCACCATTCGAAACAGTCAGCCTTCGCTCCAGCCACAGTCCCTCTTG
TCCCGACATCCACCACCGCATGCACCTGCCGCGGCCGCGGCCGCCCTGCCTACCATAACGCTCGATCCACACCGCCCTGT
TGATGCCCTGTCCTTTACCAAGACCGAGCCCGCCGATGACGTCGCTGCACAACAGGCTCAACAGCAGGAGCAGAGCCGGA
GAGCTGGCTCCAACTCTGACGAGGATGAGTTGACCCCTGCTCAATCCCGCCGCAAGGCACAGAATCGGGCTGCGTATGTC
TTACCTCCCTTCATTGTCTCCTTTACCCCTGCTGTTCGAGTCATCAGAGATATGCTACTTGTTTACCTCTGTTACCCTAC
TGACTCTATTCCACTTTGGTTTTATAGGCAACGGGCTTTTCGTGAACGAAAAGAACGCCATGTCAAGGACCTCGAGGCTA
AGCTGGCTTCTCTCGAGGCAGCCCAGCAACGAACAGCCACAGAAAACGAGAGGTTGAAGCAAGATTTGCAAAAGGTCAGC
ACGGAAAACGAGATACTGCGGGCAACGTCGTCGTTGCAGGCTGCCGCTATCACAGCGGGAGGCTCCCCGGGTAGTGACCA
CGCTGTTTCCCGCAATGCGCCTCTGACCGCGGGTCCGATGACCTACAATCCCACCGATTTCTACACCGATTTACTAGCCA
ACCACGACAACAAGCTACCGAGCCATCGCATAGCTACGTCTGACGCGGGTGAGCGTCTCCTTGCCGCTGGCGCAACGTGG
GATCTCATCATAAGCCACTCTCTTTATAAACGCGGGCTTGTCGACGTGGCCGACATCAGCAACCGGCTCAAACACCAGGC
CAAGTGCGATGGTCAAGGTCCAGTTTTTGAAGAACGCGCGATTATTGCTGCTATCGAGCAGAGTGTTGGTAGTGGCAGTG
ATTCGCTGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62