GenePrediction:GLEAN_3000 Details

Name: GLEAN_3000
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:75359..76005 (+ strand)
Length: 647
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:75359..75550 (+ strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_160:75613..75666 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_160:75737..75854 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_160:75911..76005 (+ strand)
Length: 95
>GLEAN_3000 class=GenePrediction position=GCSC_160:75359..76005 (+ strand)
ATGACGGCGTCGTCGGCGGGGTTGGTTTATGTAGCGGCCATCATGGCGGTCGTCGGAGCTGCCGTCGGATCCGCCGTCGA
GGTCTCGCCGTCCGTCAACACGGCTGAGCTGCTGCACGGCCACCTGATGGCACGCTCGGCCATCAGTCTGCAGCCGTTCC
GGGGCGACCTGGCCGGCGTGGCTGCCGATGCGGTAAGCGAGAGAAACGGTCCCGAGATCAGACACAAGAGACCAGTGCTG
ACGGCCTGCCACAGATCACACAGTCGTCGGACTCGTCCAGGCAGTACGAGGTCAACGGCGACACATTTGTGCGTCTCCCC
TTTCCCCCTTCCAGACGGCAAGACTGCGACTGACCAGAGGACCTTCTCGACATGGCAGATGGATTTTGCGACGGCAGCAT
CCCGGGCCTGTGATAACCAGCACAACAGCTGTGCGGACGCGGCCAACCGCCAGACTGCGGTCAACGTGACGGTGTCGGAC
TGCGACACGCAGAACAGTAAGTCGCGGACGCTGTCCTTCTCGTGGGGGCGCAGCCTGCTGACAGAGGCACAGCCGAGTGC
AAGGCAGTCGCCGCATCGGCAACACAGACGGCCTTTCCGGTGCTGACGACCTCAAACACCGAGTTTGACTTTTTCTGCGA
CCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62