GenePrediction:GLEAN_3001 Details

Name: GLEAN_3001
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:90220..91947 (+ strand)
Length: 1728
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:90220..90442 (+ strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_160:90504..90636 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_160:90684..91808 (+ strand)
Length: 1125
Type: CDS
Source: GLEAN
Position: GCSC_160:91863..91947 (+ strand)
Length: 85
>GLEAN_3001 class=GenePrediction position=GCSC_160:90220..91947 (+ strand)
ATGACCCTCTCGCCCCCCACGGCTCTTCCTGCGGTCCGGCCATCGATTGGCTGGGCTGTGGCACTTGCGGCAGTCTCGCT
GATCTGCCTCTTTGTCCGGCGGTCTCGCCGTTCCGGGCTTCCTCTCCCGCCAGGCCCCCGTGGCCGTTTCCTCGTTGGCA
ACCTCGGCCAGGTCAGCGCAGACCATCCCGAGCGAGACTACATACGATGGGGCAAGGAGTTCGGTTCGTCGTTCTGTCGG
CTTGTCCTTGGCGGCCTGACTGTCTGCTCATGCTCTTGTGCCAGATTCCGATATCATCCACCTAAAGGTCCTCGGCCAGC
ACTCGATCTGCCTCAACACAGTCGAGGCGGCCACGGAGCTGCTGGACCGACGGGGATCCAACTACTGTGACAGGCCGCGG
TTCACGCTATTTGAAGTGTAAGCTGTCGGGATTTTGGTTGATGTTCTGTTGCTGACAGTCTCAGGATGGGCTGGGGCCTG
ACCCTCACCTTCCTCCGCTGGGGCCCACAATTCAAGCTACACCGAAGCCTGTTCCAGAAGACGTTCACGCAGTCCAACGT
GAAGGTGTTCCGACCGGTGCAGCTGCACGAAGCCCGCAAGGCAGTGCGCACGCTGCTCGTCCGACCGGATGCTTGGGAGG
AGGCCACGCTGCTCATGACGACGAGCATCATCTTCCGCATCGCCTTTGGGCAGGAAATTGTCGATGTCTCGTCACCGTAC
TGCGCCATGTCTGCAGCTGCCAACGAGGCCACGACCAACGGCGGCATTGCCGGCACTTCACTGGTCGACGTCTTTCCGCC
GGCCCGCTTTCTGCCCGACTGGCTGAACCCATCGGCAGCTCTGCGCCACGCCCGCAACAGTCGTGCTGCCATACGGACGA
TTCACGACGTGCCCTGGGCAGCCTCGCTCAAGGACATCGAGGCCGGCGAGGCGCCGCCGTCGTTTATGCGCACACACTAC
GAGCGGCTGCAGGAGAGCATCCGGGCCGGGCGGCCGCTCGAGATGACCGAGCGTGACGTCAAGGGTGCCACGGGCGCCAT
CTTCATCGCCGGCGGAAATTCGACCTGGAGCACGGTGCTGTCGAATCTGCTCTTCCTGACGAAGTACCCCGACGCACAGC
GTGCCATCCGCGACGAGCTGGACACCGTTCTGGATGGTGGCTCTCGGCTGCCCGAGTTTGACGACCGGACCTCTCTAGGA
AGTCTGGACCGCTTCATGCAGGAGGTGATGCGAGCGCTGCCGCTGAATCCGCTGGTCATTCCGCACAAGAGCCTGCGTGA
AGACGAGTTCCGCGGCATGCGCATCCCGGCTGGCTCTGTCGTGTTTGCCAACGCCAAGGCCATGGGTTCTGACCCTCGCG
TCTACAACGACCCCGAACGATTCGACCCCGATCGCTACACGCGCGGAGAGCCGTATCCCAACGGCAACTTTGGCTTCGGT
CGCCGCAAGTGTCCCGGGAACTTCCTGGCCATGGCCACGGTGTACATGTTTCTGGCGACGCTGTTGGCAGTGTTTGAGAT
CGAAAAGGCCGTTGGCCCGGACGGGAAGCCGGTGGAGCCGGTGCCGGGCGTCACCATCGGCTTGGGCGGGTGAGTTTTGG
GTGGTGGCTGCTCGCGTTTATGCTTATGCTAACTGCTGGATAGGCACCCGTCCCCATTTCAGTGCAAGCTTCGCCTGCGC
AACCCAGCTCTAGCCAAACTGCTGGCTGAAGGTAAGGACGAGGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62