GenePrediction:GLEAN_3002 Details

Name: GLEAN_3002
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:95841..99296 (+ strand)
Length: 3456
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:95841..98925 (+ strand)
Length: 3085
Type: CDS
Source: GLEAN
Position: GCSC_160:99016..99296 (+ strand)
Length: 281
>GLEAN_3002 class=GenePrediction position=GCSC_160:95841..99296 (+ strand)
ATGGATGCTCGGTACCGCTACGCTGCAGCGCCCAGCAGACGGTCGCCAACACTGCACAATCCTGGCCGGGCGTCTATGCC
TGTCGGAATTGGCAGCACCAGCACTTCCGCCACTGGCTATCCGGCCTCCTTTGCTGAGCCTCGTGGCCTCCGCTACGAAG
ACCCCATTACGCCTCGCAGCCAGGCCACCGCCGACTATCGCTCGAATCCCTCCGTTCCCACCCCGCCGCAGCTCCAGCAG
GGCCAACCGGCTGCTCACCAGCCTCACCAGCCTCACCAGCCTCATCAGCCTCCTTCTCTCCATCACCAGACACATCCGCA
TCCTTCATCCCACGACCCTCACTCGCATACACACCATCTCGCCCCCATCACCACCACTACCCGCGCCTATGCTGTGACAG
CTGAACCCATCACGCGCAGCGCCAGTGCCCGCGAGAGCAGCCGTCCGCCTGCTGCCGACGTCGCTCACAAACGGCCTGTC
ATCATCACCACCACAACTGCCACACGTCCTGCTTCCGGCCATCCTGGCACCCACCATGGACCTACCTCGCCCACTCGTGC
TGATCACTTCCGTCCCCCTGTCGCCGACGATTTTCCGCCGCGCAGCACTCCCGTTCGCGAAGACCCCAACTACTACGCCG
TGCCTGCCACATCGACCAGCTCGCACTCTCGAGGTAGTCGCTACTCCTACGCCGGCGCCCCGATGAGTGCCACCGTTGAC
AACGAGGAGCTCAGCCGTCTGCGTGAGCGTCACGAGCTGACCCGCGCCCGTGGCACTCGCTTGGATCCCTATGTCCGTCC
CCGCCCTACTTCTGTCTACGGCACGACAAGTCGCCCCGGTGTCTCCGTTCACAACGGCAACGGCTCTGCTGCTAGCAGCA
TTCCCTCAGTTGTGCCCCTCACGTCGGCTGCTGGCCTGCCTCCCATCGATGTCGGAGGCGACGCCGGATACGAGTACACT
ACGCCTAGCGATCTGGCCCGCTACGACCTCAGCCTGGAACAAGCCCCTCGGCGAAGCCGTCGCGACAGCTTCGACCGCAA
CTACTACCGCCCCACCGTCAGCCTGACGACCGATCTGGCCCGACCCTACGGCTTTGAAACAGGCGCCCGCCGTGTTGGAG
GTGGCAATGGCCCGCCACCTACCACATGGGCCTTGGACAAGCTTAAGTGGTCCGCCCCGATGTCCGGTGCTGGCTCAGGC
ACTGGCTCGGGCACAGGCTCGGGCACCGGCCCCGTCCCCGTCTCCAGTGGCACTCCATACGATGCCAAGTTAAACATGCG
TTCGTCGCCTGTGCAGCCATACGGACGCGCTGCCCCAACTGGCGCGGCTCTTCCTGCCTGGGATGTGCACGACCGAGAAT
ACTCGTTGGAACGGGGCAGAGACAGGGACTACGACCGGCCATACGAGCGCGATCGCGACCGCGATCGCGAATACTATGCA
GACGGTACGGCTGCAAGCCGTGCCTATGGCATCCTCGTCAACAGCAGAGACCACAAGATGCAGCAACCCCCGTCTGATGG
TGCCTATTACGATGACTATCGCAATGCCTATGCCGACGACTATCGGGACGATCCCCGCCGAGAGGGCCACCGTGAGCGTC
CGGATCCTCGCTATGAGCCCGACGATAGATACGACGACCCGAACTACGATGCCGCTCGTGGCCGGGATGGTGGCCGTCTG
CGAATCGAGGCCCCCGCCAGGCGTCGCTCCGACGAGGATCTCTACGTTCGTCACAAACGGGATGCGGCACAAGATGATGA
AGGCCGTGACCGCAACCGCGATCGGGAACGTGAATGTGAACGTGAACGAGAACGGGAACGCGAACATGATAACCCGGGCC
GTGTTCACGATCGGGACCGTGATCGTGATCATGACCGTGATCGTGACCGTGATCGTGACCGTGACCGTGACCGTGATCGT
GACCGTGATCGTGATGAGGACTCGGACCGTGAGCGTCGTCGTGAACATGAACGTGCGTACGATCGCGAGCAAGGCCGCTT
CCGGGGAAATCAAAGAAGCGACGAGGAGGAGGCTACTGACGGGAGGAGGTCCCGAGATAAGGCGACTGCCACTGGGGTCG
GCGCCACGGCGGCTGCCATCGCAACAGCAGCAGCAGCAGCTTCCTCTAGCAGCAGACACAAGGACCCCTCTCCGGAGAAG
GAGACACAGTCTCGCCGGCGGCGCGACTCTGATGCTAGCGAGTACGAAGAAGACCGCGATCGTGATCGGCAGCGGCCGCG
ACCCAGGTCAGACAGCGCAGGTCCGAAATCATCTGCTGGCCCGGTGCCGTCTCAGGTGTCATCGGACGATGCTGCGGCTG
TTCAGACACCTCCAACATCAGACGATGGCGAGGCAGACGAGAAAGCTTCCGGCCAGTCGGAACGGGAACGAGAACGGAAG
CCCCGGACCGCACCTGCTTTTAAACCCACAGATGCCAGCGATCTGAGGACGCTCAAGGCCGAACTTGCTGCACTGGAGGC
CAAGGAAGGGCAGCAAGCGGTGGCGCAGGGCCCAGCCAAAAAGGCGAATGGGCGATCCGGCAAGGAGGATTCCAGAGACG
CGACAGAGAGAAAGGCAGACAAGAGAGACAAGAGAGACAGGACAGACAAGGGCGATGCACTCTCGCCGGGCGTCCTGACG
CCAACATCCACTCCGTCATCTCGGCCGTCGTCGCCTCACACCAGAGGCCGGAAGACGGATACAGACGCGAAGGATGATTC
CGTTCGGGGACGCGACCCGTCGCAGTCGCACGCAAAGGTCCTTGCCGAACGACTGGTCTCGCCGCCGCGCGACAAGGATG
ACAAGAGGCCGCTGAAGGGCATTCTCAAACAGCCCAGCTCTAAGTTTCCCGAAGAGCCCAACCCGGTCCGCCCGGGTGTT
GCTCCCCACAAGGACGACAAGGTCAAGCAGCAGAACGTGCCCCCTGGTGCACGGTGGACCAAGATAAGCCGCAAGCTGGT
CAACCCTGAGGCCCTCACGATTGGAAAGGAGCGGTTTGAGGTCCGGGACGATTTTGTCATTGTCCTGCGTGTTCTCAGCC
GTGAAGACATTGAGGCCTACACCGTGGCCACGGCACAGCTGAGAGGTATTGTTCTCTTTTCTTTGTCTTTCTTTTTCTTT
TACTCTTTCTCTCTCTCTCTCTCTCTTGTGCAACAGGTCCCTAATGAAACGACAGACAAGCGCCGGAAGGAGTTTGAACG
ACCGATGCTCCGCATCGACGACAAGCCGCACCAAGAGGAGGAGCACCACCACCACCGAAGCCGGCGAGACCGCGAGCGGG
AGCCCGACAGCAGCGAGTGCTACGGCGCGGCGGCGACAGGCGAAAAGGACCGCCCGCGAAGTCATCATCCCCGACACGCG
TCGGATGCGTCTGCCAACGGCCCTGGCGATGGCGACCGAGAGGAGATCGAGTACTACAACAGCCACGGTGCGCACCGGCG
ATACTACCGTGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62