GenePrediction:GLEAN_3003 Details

Name: GLEAN_3003
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:112109..112858 (+ strand)
Length: 750
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:112109..112336 (+ strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_160:112481..112858 (+ strand)
Length: 378
>GLEAN_3003 class=GenePrediction position=GCSC_160:112109..112858 (+ strand)
ATGTGGGAGACGTCTTGTGACGATGCCACGGCTAGAAGAGAGGAGAGGACTGTCTCTTGTCATCTGGAGTGGCCGTGCAA
GCGCTCTGGCTGTCCCGGGCCGGTGGCACAGCAGCAAAGACAAATCGGTGGCAAGACAGAAGATGCGTCGGCTCGTCTGG
CAGCAGAGGCGGTGGCCATGCGGCTCTTTCACGGTGCTTTTTGGGAACTGCTGGGCCTCTGGCACTCGGTATGTCGGGCG
GCATCTGCAGGTACCGGAGGCACAGACGCGTTTGCATTGCATCACAATATTTCGAGCGAGAGGTGGTGAACAAGATCTGC
GAGTGGGATGTTCCAGGGTCGGGGGAAAGCTGTCAAAAATCGGATTGGCCAGGATCCGCACTCCGTATCGCGCTCTGTGA
AGGAAATGCACCTGGCAGGGGGCGGGCTCGGGGCCGCTTGCTCTGCGTATGGAGCACTTGTCCATCCCATCTCATCTTGC
TCTGAATACGGATACGTCGTAGTGTCCGTCGAGTGCCATGGCACCGTGGCGCCGTGGCGCCGTGGACCTTGCCCCAAAAC
AGGCCGCCGCGCAGAGTGGCAACGAGCGAATGGGCGCGCTACGGCGAAAGTATACAGCGCTATGGGGCGCTACGACGCGC
TACTACAGGCAGCGTATGTGCCCGCACAAAGCACGGCATTGGCAGAGGCGGCGGCTGGCGTTGAGAGCGATCGTGTGGGA
GACGGAAAAAGAAAAGACAAAAAGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62