GenePrediction:GLEAN_3004 Details

Name: GLEAN_3004
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:125398..128344 (+ strand)
Length: 2947
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:125398..125558 (+ strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_160:125942..128142 (+ strand)
Length: 2201
Type: CDS
Source: GLEAN
Position: GCSC_160:128211..128344 (+ strand)
Length: 134
>GLEAN_3004 class=GenePrediction position=GCSC_160:125398..128344 (+ strand)
ATGTATCCATTCGGCTCGGGACCTTCGCCCGGTCCATACGGGTCGGGGGGTGACTATAATCCCAGGACGGCAGAGTCCCT
GGAAGGAGAGATAGCCCTCTTGCGCAGCCTTCTCGCTTTGCAGACATCTTCTTCTAGCAGCTCCGATTGGATCTCCGATT
GGTGAGTCCATATTTGTTCTCGAAGAATTGCTTGCTGCTCGCTCTACTTAGCCCTTTCTTTCTTTTGTCTTTCTTTTGTT
CGTTTGGCTCTATCCCGTTCAAGTCTACCGTGATCCTTGGACTTGGCTTGTTCTTCCAGACAGATCATGGCTTCCGTATA
GCAAATGGAGATTCCAGAGATATATCCCAATATGAAAAGCCAGACAGAAGACACCTTGTTTGGATTTTTTGCCCTTTCTG
TCGTCTCTGGATAAACGCTCTATAAACGGAGAGAATTCATATCACAAACATCTTGTTATAAGAACGTCCTCGCTCGACTT
CTTATCGTGTCTTGTCACGTTTAGCTGTTCTATCTGAATGGAGTCTGACAAAAAGAAACTATAGGGAACGCACGCGGTCG
CCCAGACCTGGCCTGAACTCTTTCGGATCGCCGTACAGGCTCCCGCAGAGACCTTTCAATGCCCCGTTGCGTTACTGTGC
ACGTACGCATCGCAATCCTAGGGGACTAGAAGTGCCCGAGAACACTCTGCCGCATGGTGTACCTCCTCCTCCACAACCGG
CTGCCTATCGACAGGCACCGTCTCTCATGAGACAGGAATCTGCAAGAAACTGGACAGAGATTCTGAGATCCTCAAACATA
GCTCGACAGGACTCGCCTCCTATCTATCCCACAATTGGCCCTTTTGCCAGTCAGTTGCCCAATGTTTTTACGGATAGGCT
GCCTGTCTTTGACATGACTGGTGCTTTCTCTGGCACGCTGCCTGAGACTTACACACGCAGACAGGCACTGTCTTCTTTTT
CGACGGAAGGCGGCAACATAGATTATTGTCCTGCTAAATCGGGCCTTGCCAAGTCGGCTCCGGCCGAAGCTTCCTCGAGA
CATAGCACAGTCCTCGACATGAATGATATGAACGAGGCTCATCTTCCGAAAGAGCTTCGATCTTTGCGGGACGCAGCTAG
AAATGCCGGCATTCGTGTCGGTTTGAAGAATGAAACTCCTGACCAAAGTGGCCGCTCATCTCCGCTTTCGGGAAAGAACA
AAAGCGTGCTTGACCCATCGTCGTCACCGTTCAAACCAACAAACACGGCTCCGGGTAAAGCCAATATGGTAGCCAAGGCT
AGTGCCGGAGTTCTTCATGCTGCCGAAAATCATATTTCAGGCGAGGTCGATGCGCGTCGCTTTGCGACCCCTAGCCCTCT
TCGAAATGTCATGTCCTTCAGTGATGCTCCTCTGGATGGCATAATTTCGGAAAATGCCAGTGGCTCCATTGAAAATTTCG
AGGCAGGTCGTTATGCATCGTTTTTCCCGGCTGCGTCTACAACCACTCTTGATGTCTACAAGGCCCACTCGGAGACTCCT
TACAACATGGCCGGCTCTGGGTCGGATCCCGTTGAGTCTTCTCGTGCAAACGAAGCTAGAACCTGTCTTTCTGCTGAAAG
CTCCCAGGAAGAAGATCATGATGATGACGACCAAGAAGACTGCCAGTATTTCTTGCCTCCCGGGAGTCCTATCCTAGACT
GCAACGACAGCCCGAATGTTTCCATGTCTGATGCGGACGTTTCTCTTTCCCTGTCGAAACTTTCGGTTTTGCCACCTTCG
ATGCGTCTGGGTCTGCACCCTCGGGTTGCTCTGACTATGGCCAGTACTCCTGCAGCGCCCGAGGTGGCCAGAGTGTATCA
AGACCTCACCCCCGAACTGCCAACCATTTGGGACAGTCGGGATGACACTGCTTATCGTGCCGGTATAGCAAGAGATGCGA
GGAATAGAGCATTTAACACATTCGGAGGACTCAACAGCAACGCAACACAGTATGGAACGGCCAGCCATTCCAGTGGCGGC
TATGGGAATCAAGCCGATGCTGGAGGCTCTACTTCTCATGTGCCCACTGCTGTCGGTACGGGCCTGCAAGATACCGGTCA
TGCCAATATGAGTTCCGGTTTTGATCATACGGTAACATACCGCACTAGAGGCACTAACTCCAATGAAAACAATGCTAGCT
ACCACCAGGATCTATCAGTGGTTCCTATGTCTATGCGTCTGCCGGACGAAGTTCAGAGCACTCACAATCCCGACCTTGTT
CCTGGTCGCGAGCTGGAATCAGAGATTGACCCTGAAGATCAGGCTCTTCCGGCCTCTGAATTCCCCGCAGCTCGGTACTA
TACACCGAACGAGGTTGACGGGGGAAGCAACTTGGGCCCGAACATCTCGGGTCCTAACGCAACCTCTGGAAGACTCGCCC
CGTTCAGTACTATTCCTACAGCGACATCGGGGCGTGGCAACGGCGAGCGTCAGACAGCATTCTCGACTGTAGCGACCTTT
GCTGCTCAAGCACAAGAACCCACTGCCGCGGTGCCGATCCCCATCCCAGTCCCTAACCCTCGTGCGCACGGTATGGGCCA
TGTTGTCGACCATGCGCCCCGACAGCATGTGGAAAACTGGCAATACATGGGAATACCTGGACGATACGCTGAGTTCATCA
GGGCACGCAACGAGATGAGGGCCCAAGCCTTGAACTCCGGCACCAATACTTGGCTGCCTACAGGAAACGAGGAGGGACAA
TCTGGGCTTCACGAGGTAACAGCTTGTATGGTCACAACATATCGCTGCGCTATTTTTTTTATTGTCTCTGTGACTAACGG
ACTGGCATCTTAGCTAGCGACGCCCTGAGGCCGATCGGGCACGGGAGACCACGGCCTCGATCTTCTGAGGGACAAGATTC
GCGACCTGTCTCACCTCAGTCATCCGTCAGCTCCGGCGAGTTCATGGTTTTCAAGTTCGACCCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62