GenePrediction:GLEAN_3006 Details

Name: GLEAN_3006
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:158516..165123 (+ strand)
Length: 6608
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:158516..158739 (+ strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_160:158800..159213 (+ strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_160:159262..159420 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_160:159476..159572 (+ strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_160:159633..160124 (+ strand)
Length: 492
Type: CDS
Source: GLEAN
Position: GCSC_160:160184..160435 (+ strand)
Length: 252
Type: CDS
Source: GLEAN
Position: GCSC_160:160492..165123 (+ strand)
Length: 4632
>GLEAN_3006 class=GenePrediction position=GCSC_160:158516..165123 (+ strand)
ATGACCGTGCCGTCGCAGAATGCCTCCCGGCGGACCGGCAGCGGTGGCGACCGGGCACGCTCTCCCACCGACGAAGACCC
ATTCAGCAGGGATAAAAATCCGAAGCGGAGAAAGACAGAGTCCGACGTCAGCCTGCCCAACTGGGAGAACCTGCAAGGCC
GAATATGTGCCCGCTTTGGCCTGGTGGCGGGCGAGAGCATCAGGGAGACACTCGTTCACATGTGGTAAGACGAGCTTTTG
TTCAATTACGTATGTAGGCCGAGGATCGACTAACATGGACCTAGTGATGAGCTGGACAAGAATGGCATCGGCAGAGACGA
GACAGACATACTGGCGGCGATGCAGTTTCTCAGCCAGACAATATGCGTGCTCCATCAGACGTGTGCTCTTTCCGACCCGG
AGGACAACGACTCGGCGTTTATGTGCGAGTATTGCAGCTCTGTGCACCTGGAGGGCAAGATACAAAGCCCCAATAGTGGA
GAGGATGCGAAGTGTGCATACGAACTTTTTGAGAGAGTGGTCACGACGCTCGTTGCTCCGGGAGCAGGACCGCTTACGGT
CCGGGCATTGATACTCCTCCGTCGCATCGTCCTCCACAGCACCACCATCAATGTGCTCGACTACGACCGCTCGCATCTAT
GTAAATGGTGCTCTTCGCAGCTCTACAGCCCTGACAATGCCGTGCGCGTCCAGGCCGCGTATGTAGTTGCGAATCCCTCA
TAATAGATGGTGCTGACATGGATTAGGAAATCGCTCAGTGCATACACGTGCAATCGCGGCGAAGAGACGGAAAAGGCGGT
ATTGAAGAATAGGCAGCGGTTTCACCATGGACTGAACCGCATGTTCGAATCTGGAAACTGTGCGGTGCAAGAGACAAGTG
CGCTTGTCTGGACACAGCTGGGAATGTACGCAAGCGGGTCGGGCTTCTTTCACATGGCCACTTATTCTGACGCTGTGCAG
GGTTGTCGCCGAGAACGAGCTCGAGCCAATGCTCCAGGGCCTTCTTCTGCATCTGGACAGCAGCCATAAGCCAGTCCGCG
ATGTAGCGATATCAGAGGTGAGAGAGGCGACGACGAGGCGAAAAGGCAAATCAAGAAGGAGCTGACGTGTTGGCCAGCTT
CGCTATCTTGCTTCGTGGTTTGGACGAACACCAAACGAGCTGTTCGAGCCATACTGGCGAACCACAGCGTATCAGATCGT
CAAACACATAGCTGAGCGGCCGGCCGTGGCGACGGCAATTGCCAATTTGTTTGGCATGACGGCCACGAGGCTGGCGTTGC
GGCTGCAGTCTCACGCCATCCCTGATCTGTTGTTTCGGAAGAACCTGGCGCCCATTAGCAAGATTGCCGAACTGCGCGGA
GACGGCGATGAGCTGTGGCCGACGCTGATCGACAAGGCAAACCTGACGTCGATCCTGGCCTTTTGGGTGCAGCTCCCGTC
CGACGTTGCGACGTTGGACGATCTGATGCTGCCGCTGCAGGACCTGTCTGCGCGGCTGGGGCCTGCTTCCATCCGCGAAG
TGATGGGTGCCGCCGCCATTCCGGTGCTCTCAGAGCTCTTTATTCGGCTGACATACAGCGTGGAACGGATTCCAGACCGG
TTTGAGACGGTAAGTTGGCCGCTCTGCTGCGGACCGCAAGCAAGCAGACCTGACCGTGTCGCTCGCAGATCTCGGACGGC
ATTGGCTTCGCGCCAATCCTCACCATTGCGCGGCTCTTGAAGAAGGACGCCGAGACACAGTCGGATGAAGAAGTTGTGAC
GGGCTTCCTGTCGCAACATGTGCTGGGCTTGACGACTAGGCTGTCGGACGTCCACGTATACAACGGCAAGAAACATCTGT
GCCATTGGATCGACGGCATAGAGGCTTTGGAGATCCTGATCAAGTATCTACGGTCTGCAATACGGACTGCACGTCCACAG
GTAGGTAAACCCCAGGGCTATGTGAGTATGGATGATTGCTTACATAATCATATCAGGTGACCTCTTTTCTTCTCGATGCG
CTTTGCGACGACGGGGCGGAGTATGCGGCCTGCTGGCGAACCGGGGTGCGCCGTGTAGCGATCTCGTGCTGGGCGACGCT
GGTGCAGCATGTGGGCGACGAGAACGTGCTGATGCTGATGGAGACGACGTTTGCGGTGATCCGGAAGAACTGGGAGCAGT
TTGGCGAGTCGGAAAAGGCGACGTGCAAAAGCCTGCTGGCATGGTTGCTGGAAAAGCCGGACGGACGGAATCACCGCGAC
TGTCTGCTGGACAAGATCGACCTGCTGCCGCGGCTGAAGATCCCGGAGCTGCAGAACGGCGTGGGCGGACGGCTAGACCG
GCTTCACCATACGCTCGGTGTGATGCAGACGATCGACCTGTTTGCGCAACGGATCCGACACGAGAACCTGGACGTGATCT
GGGTGGCGCTGGAGGAGGCGCGCGAGTTCCTCGAGGGCAACCAGGATGCACTGCAGGCACCGGCACAGGGCGAGAAGTCA
GACTCGGCGGTGGCCGGGCTTGTGCGGGCGCTTCTAGAGTGCTCAGCCAAGTACAGCGCGTCAGAGCCGGCACTGGCGGC
GAACTGCCTGACGTGCATCGGACTCGTGGGTTGTCTGGACGCCAACCGGCTGGGAGCAGCTGGCAAGGACGCGCCATTTG
TGGTGATCTGGAACTTCCGGGTGGCGGAGGAGTTTATCGACTTTGTGATGTACATGTTGCAGCACGTGCTCACGCGGGCG
TTTCTGTCGGCGACCAACTCGACGAGCCAGGGACTGATCGCGCATGCGGTGCAGACACTACTGTCGCGCAGCGGGATCAG
CGCAGCGGTGCAGAGCCGCGGGGCACAGATGCCAGAGGCATACGACAAGTGGCGGGCGCTGCCAGAGCTGGTGCAGGTGG
TGCTGTCGCCGCTGTTGGTGTCCAAGTACCACATTGCGCCGCCGGGGCCGATGCAGACGCGGTATCCGATCTTCCGGGGT
GGACGGACGTACGGCGACTGGCTGCGGCTGCTGGTGACGGACTTGCTGGCGAAGCCACAAAACGCAGCTGGCAAGATTCT
TTACGAATCGCTCTCGCGGGCGGCCAAGGGGCTGGACCTGGCGGTGGCAGAGTTCCTGCTGCCGTACCTGGTAGTGTACG
TGGTGACGGGATCAGACAGCACGGAGCAGGAGCGGGAGCAGATCGCAGCGGAGCTGAAGCACATCTCGGAATACCAGCCG
GCAGATGCGGCGCCATCGGCGGAGCGCGAGCAGGCTAAGCTGTTCTACGACGCAGTGTTCCGGGTGATTGAGTACGCGAT
GGTGTGGCTGCGCAGCTGCCTGCATTACGAGAAGCCACAGGGCGTGGGGCAACTGGAACGATTCCTGGAGGCGTTTCCGG
CAGAAGTGCTGTCGCAGCGGGCGATGTACTGCCGCGACTACGCGCGAGCGATGTTCTTCCTGGAGCCGGTCGCAATGGCA
GCGGTAGCGGAGACAGACACGGATGGAAGCGGGCGGCGAGAGCGGGCGGAGGCAGACCTGATCGACATATACGCGCAGAT
CGACGACCCCGACTGTTTGAGCGGGATCATGAGCAAAGCTGGCAGTCTGATGGAAATGAACACACATCGCAAAGCGCTGC
TGGAGCAAAAGGCCGGACGGTGGGAATCGGCGACGACGTGGTATCTGTCAGACCTCAGCGCGGAGCCGGACAACATGGAG
ATCCAGGCACGAGTGCTGACGTGCTTCCTCGAGGCGGGCCACCACGACGCGCTGCTGGCACGGGTGGACGGGATGGGACT
GGCAGAAGCGGTTCCGGCGACGGTCAACAAGGTGCTGCCGCTGGCGCTGGAAGCAGCATGGGCGACGTTTCAGTGGCCGC
GGCTGTCGGCGCTGGCGGCACTGCACAAGGGCGAGGTGGCGGACGTGTTCAACGTGGGCATCGCGCGGGCGTTGTGTCAC
CTACGACAGCAGCAGACGGATGAGTTTGGTCGGGTGCTGGACCGCATGGTCGACGGAGTGGCAGCAGCGGTGTCGTACTC
GACAACGTCGTCGTTGCAGGCGTGTCACGAGACGATGCTCAAGGCCCATGTGGTGACGGATCTGCGGATGATCGGGGCAG
CGGCAGGCGGGACAGCAGAGACGGCACGCAAAGCTCTGGCGACGGTGGTGCAGCGGCTAGATCTGCTGGAAGACGTCAGC
AACAAGCGATATGTTTTGGGACTGCAACGAGCAGCGATGGAGGCGATGCGGCCGACATACAGCGACCGGGCGATTTCGTC
GCTCTGGCTGCTGAGCGCGCGACTGGCACGCAAGACAGGATCGAATGGCGAGTGTCTCAAGGCGATTGCGCATGCGCGCC
AGCTCAACGACCCGGCAGCCGAAGTGGAAAATGCGCGGCGACAGTGGGCATGGGGAGGACGACACCAGGCGATTGCGGAT
CTGCGCACGGCCATCGGACGGGGCTTGCTGGCGGGCGACGACGAAGGCACAGACAAGGACACCAAGGACAACAGGTGGTC
GGCACAGGATGGAGCACCGTTGGCAGCTCGGGCTGGGCTGCTGATGACGCGATGGCTGGATGCCAGCGGCGAGACATCGC
GATCGGCATTGCGAGACGAATATCGCGAGCTGGCCAGCCGGTACGGCGAGTGGGAGAAGAGTCACTACTTCCTGGGCCGG
CACTACAAAAAGGTGCTCGAGTCGGAACAGACGCTGAAGCCGGACGAACAGAGCGATCTCTTCCTGACGGGCGACATGGC
GCGGATGGAAATCGAGCACTACCTGCGGGCAGCCAAGTACGGGACCAAATACCTGCACACGACATTGCCGCGGATCCTGA
CGGCCTGGCTGGCCCTGGGATCACAGGTGGACCGGGCACCCGACGGCAAGGCGGCCGTGTCGGACGAACTGCGACGACGA
CGCAACGAGGTGTTGACCAGCCTGCACAAACGACTGCTGCGTCACGTGCAGCGACTGCCGGCGTTTATTTTCTACACAGC
GCTACCGCAGCTAGTAGCCCGAATCAACCACCCCAACAAAGAGGCGTGTCACGTGCTGGACCAATTTATCGTCAAGGTCG
TCCTGGCCTATCCGCAACAGGCGCTCTGGAGCGTGTTCGGCGTGCTGACGGCACGAGCTGGCCGCGGTCAGAACCAGACG
AAGCGGGCGGCTGAGCGGCTGCTCAAGGCCCTATGTGCGGCGCCAGGACAGCCGGCCGCGGCATCGGGAGCCCGGCTGCC
CTCGCTGCAGTCCATGTTGCGCCGAGGAGTCGGGCTGGCTGACGAGCTGGTGCAGGTCGGCCGCAAGGGCAGCTACCGAG
CCAACAGCACGGCCAAGGCCGTCAGTCTGAAGCGAGACATGAACTTTGGCCAGGCCAACCACTCCTTTCCCTTTGTCGTG
CCGATTGCACGATGTCTGACGGCAGTACTGCCAGGAAGGGCAGCGGGAGGAGGAAGAGGTGGTATGGGAACAGGGCTAGG
CCCGGGTATAGCAGACAGCATGACCAGCACCAGCAGCACCGGAACCAACTTCTCGACACACAATGCGTTCGCGGCCGACG
TGATCACGATCCAGTCGTTCCAGGACGAGGTGCTGATTCTCGGATCGCTGGCCCAACCACGAAAATTGACGATGCGCGGC
TCTGACGGCCGGCTCTACGACGTGCTGCTCAAGCCCAAAGACGACATGCGGACGGACCAGCGGATCATGGAGGTCAACGC
GCTCATCAACCAGGCCCTGCGCAAGGACACCGAGGCCATGCGCCGGCAGCTGTCGATCCGCACGTATGCCGTCACGCCGC
TCAACGAGGACTGTGGCATCATCGAGTGGGTGTTGGGACTCAAGACGTTGCGCGAGATTGTTCGGCCGTACTACGATCTG
CGTCGCGGCCAGGTGCAACCCCGGCCACCCGATCCGCTCGAGATTGTCCGGCTGCTCAACGAGGCCGAGACGGCCAGCCG
GCGTGCTCGCGTCTTCACAACCCAGATCCTGCCGGCCTTCCCGCCCGTTCTGCACGAGTGGTTTATGCGGCGGTTTCCCT
ATCCGGCCGCCTGGTTTGCTGCCCGGCTGCGCTTCACGCGCTCGGCTGCCGTCATGTCCATGGTTGGGGCCGTGCTCGGA
CTCGGCGACCGTCACTGCGAGAACGTGCTGGTCGAAGAGGGCACCGGTGCCGTCATGCACGTCGACTTCAACTGCCTGTT
CGAAAAGGGCCGTCTCTTCACCCAGCCCGAGACCGTGCCCTTCCGGCTGACCCAGAACATGCGCGCCGTCATGGGCATCT
GCGACCATCGCGGCCCGTTTCGTCGCTCGTGCGAGCTGACCCTACGCCTCTTGCGCGAACAGGAGGAGACTCTGCTGGCC
GTGCTCGAGGCCTTTATCCACGATCCCACCCTTGACCTGCAGGTCGACCCGCGTCACCACCAGCAGCAGGGCAAGACCGC
TGCTGCTGCTGGCCGTCCCAAGCCTGCTCCGGTCGTCCGGCTCGACCCGCCCAGCGTGGTGAAGAATATCAAGCGCCGCA
TGAACGGCCTGCTGTTGGAAGAGACCATTCCGCTGGGCGTCGAGGGCCAGGCCTGGGAGCTGATCAAGCAGGCCACCGAC
CCGCAGAACCTGTCGGCCATGTACATTGGCTGGTCGCCGCACTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62