GenePrediction:GLEAN_300 Details

Name: GLEAN_300
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:893510..894176 (+ strand)
Length: 667
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:893510..893747 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_167:893836..894176 (+ strand)
Length: 341
>GLEAN_300 class=GenePrediction position=GCSC_167:893510..894176 (+ strand)
ATGCCGACTGCAGCTCTGCTCCGCACAGTAACCGCCGTCTCTCACAGCTTCGTCCGGCCAACAGTCTCTGTCCGTCTCCG
GTTTCTCCGTCTGCCGTTTCCGGCTGTCCGTCCACTTCGGCGCATGTCCTTCATCCCGTTTCTCGGCAGCTTATTCTCGT
CTGGCTCTGCCAAGCAGGACACCATGTCGTACCCCGACAAGCGCACTGAAAGCGAGTGGCAGGCCATCCTCAGTCCTCGT
AAGTTCTTTTCTTTCCTCTCCCTCTCTTTCCCTCTCTCCCTCCCTCCCTAACCATTCAGAACAATTTCGTGTCCTCCGGC
AAAAAGGCACCGAGTCGCCCTTCTCGGGCGACTACGACAAACACTTTGCTGACACCGGCGTCTACACGTGCGCCGGCTGC
GACGCACCCATCTACAAGGCCTCGCACAAGTTCAAGTCAGGCTGCGGCTGGCCGGCCTACTTTGACAGCCTGCCCGGTGC
CATTGTGCGCCACGAGGACACCACGCACGGCATGTTACGCACCGAGATCGTGTGCGCCAACTGCGGCGGCCACCTCGGCC
ACGTCTTCAAGGGCGAGGGCTACGACACCCCGACCGACGAGCGACACTGCGTCAACAGCATCAGCCTCAAGTTCTCGCCC
GAAGATGCGGCTGCCAGCAAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62