GenePrediction:GLEAN_3011 Details

Name: GLEAN_3011
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:189761..197775 (+ strand)
Length: 8015
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:189761..189967 (+ strand)
Length: 207
Type: CDS
Source: GLEAN
Position: GCSC_160:190060..190116 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_160:190219..190306 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_160:190531..190733 (+ strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_160:190786..191026 (+ strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_160:191207..191436 (+ strand)
Length: 230
Type: CDS
Source: GLEAN
Position: GCSC_160:191501..191676 (+ strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_160:192096..192995 (+ strand)
Length: 900
Type: CDS
Source: GLEAN
Position: GCSC_160:193100..196134 (+ strand)
Length: 3035
Type: CDS
Source: GLEAN
Position: GCSC_160:196213..196844 (+ strand)
Length: 632
Type: CDS
Source: GLEAN
Position: GCSC_160:196912..197775 (+ strand)
Length: 864
>GLEAN_3011 class=GenePrediction position=GCSC_160:189761..197775 (+ strand)
ATGGACGTACAGGAAGCGGCGCCCAATAATGGGACGAGTAATGCCATTGCGGTAGTTGGAATGGCCTGTCGCTTTCCTGG
TGCTGCTACTGATATTGAGAGCTTTTGGGAAATGCTTCGCAACGGCAAAGACGCCTGGTCCGAGATACCCGAGGATCGTT
TCAATACAAAGGGCTGGTATCATCCAGACCCCAACCGTCCAGGCAGTGTTAGTCTCTCACTACATACCTGCAGGTTCCCT
TCGTTTTATTAGCATTTGGGGAAGTTATGAGTTGACCTTGTTTTTTCTACACTGTCTAGTTTCACATCCGTGGTGCCCAC
TTCTTGAAAGAAGATATCGCAGCGTTTGATGCTCCAGTAAGCTTGAAAATACTCAAAATTCTGCATTTTCGGGGCATCAC
CACCGGGAATATTCCCGTATAGCATAATTTGAAGCCCACACTGACAACCATGATGTAGTTTTTCTCCATTTCGACGGCTG
AAGCAATTTCTATGGACCCACAGCAGCGAATCTTGCTCGAAGTTGTTTACGAAGCTTTGGATAGCGGTAAGCCGTAGATC
CTGGTTGCCAGCTCTCACCGTGTTATCGAATTTTTATATTAATTGGACATCTGTAGCCGGAGTTCCTACTGCCTCACTCT
CAAACACGACCGCCAGCGTTTTTTGTGGCTCCTTTGTACGAGGTGGGTTATTTTCCTCAGCACCCTTTGACTGCCTAGTC
AAACCGATCTATTCTATCGCTGAAGACTCAAGCTAACTTGTTAAATAAAGATTATGAACAGCCATGTATGCGAGACCCTG
ACACCACCCCTCCATACGCTGCCACTGGCAATGGCGTCGCCATACTTGCCAACAGGATCTCTCACGTTTTTGATTTCTCT
GGCACGAGCCAAACCATCGATACAGGCTGCTCTGCCAGTCTGATTGCGGTTCATCAGGCCTGCAAGAGCTTGCTTGGCGG
AGAATCTTCTTTGGTGAGTGATCTAGTCGAACAATCTGCCCTGTCATCTACTAATCATATACAAGGCCATTGCTGCTGGA
GTTGGACTAATTTTCTCGCCAAACACTCTTGTGCCCATGGCTAATCTCAATATCCTCAGTCCTGATGGGCGATGCTTCAC
GTTCGATGAGAGGGCTAATGGCTACGGCCGCGGCGAAGGAGTGGGTGTCGTTATATTGAAGCGTCTCGAGGATGCCATTG
CTGCCAACGATACTATCAGGGCTATCATTCGTGCCACTGCCAGCAACCAGGATGGACACACACAAGGTTTGTTCCCCTCC
GAAAGACATAAGACAAAGTAGTAATCTCAATCTAACTCTTCAAAAGGCATAACTCTTCCAAGCAAGGAGCGCCAGGTCAG
TAACATGACACAGATATATCGCAATGCGGGATTAAATAGTTCCCGCACAGCGTATGTGGAATGTCATGGCACTGGTACAC
AAGCAGGTGATATCAAAGAGGCCCAGGCCGTTTCCGAGGTGTTTTGTCAACAACGTACGTCGGACAGACCTCTCATCATA
GGATCTGTCAAGCCCAATATCGGCCACCTTGAGGGCAGTGCCGGTGTGGCTGGAATAATCAAAGGAATCCTTGTTGCTGA
GCGAGGGTACATTCCTAAACACCTCAACTTTACCTCGCCCAATCCTAACATCGACTTCAACAACATGAAACTTCAGGTTC
GTTACTTACTCAGGGGCAGACATTTCTTCACGCCTGTCTTTACTAATATGGCAAACATAGATTGCTTCGCAACTCAGTCC
TTGGCCAGTTGATGGACTCCGCCGAGTCAGTGTCAACTCGTTTGGCTTTGGCGGTACAAATGCTCACGTTGTCCTGGATG
ACGTTCCGCACTTCCTTGCTGAGAATGATATTGCTGGCGGTCAGCACAATACCTTCATCTACCCTAGCGACAAGTTGTCA
ACACAGACAAGAGATGTTCCTCGCCTTCCACAGAGCCATCTATTTGTTTTCTCTGGACACGATGAGGCTGGACTAAATCG
AGTTCTTGATACGCAAGCCAATTATATCAGGAACCATTCTTCTCAGTATGACTTTGACATGAACTACGCATACACGCTCT
TTTCCCGTCGATCTTCTCTCAACTGGCGAACATATGTCACCGCGGTATCGGCAGAAACGACCTCCTAGAGCGGCTTCAGG
AAAGGAGCACTATGCAATTCATTCGAGTGCCGACTCAATCCACGCCAGTTGTGGCTTTCATCTTCAGCGGACAGGGAGCT
CAATGGTTTGCCATGGGACGTGAGCTTCTCAGATATCAACGTTTTTATGCGAGCGTGTCCGCTGCGAGCTGGTACATGAG
CACTTCACTTCAAAGTCCCTTCTCGCTCTGGGACGAGCTTCATCGCGACAAAGACACATCTCGTATCGACGAGCCGCAAA
TCGCGCAACCCGCAACAACAGCGATCCAAGTTGCGCTGGTTGATCTTCTCATTGCAAGTGGCATACAACCAGCTGCTGTA
GTTGGCCACTCTTCGGGTGAGATTGCTGCCGCATACGCCCTCGGTGCAATCCACCGAGAAGATGCGTGGAAAATCGCCTA
TTATCGTGGCCAATGTGTCCGCAATATTTCCACGCTGGCCCCGGATGTACATGGCCGTATGTTGGCTGCTGAACTGTCGG
AGGACGATGCACGTCGCATGGTGTCCGACGCTGGCACTCAATCGGTTTGTATTGCTTGTATCAACGGTCCCGCGTCTGCT
ACGCTTTCAGGTGATGCTGAGGAAATATCCCATCTCTACACCTGCTTCCAAAAAAAAGGAATACGGACCGTCATGGTCAA
TGTGGATGTCGCCTACCACTCTCCACACATGCATATCGTTGAAAGTATCTATCTCAACGCTATTAAGGACGTCACTCCTT
TGCAACAGAAGTCTAACGGTGTGTTCTTTTCGTCGGTCTATGGCCGAAGAATCTTAGCCAGCGACCTAGGGGCAGAGTAC
TGGGTGAAAAACATGGTCCTTCCCGTCCAGTTTTTCAAAGCTGTGACTGAGGTCATGAGTCAAATGAGTCCTGCTGTATT
CCTTGAGGTTAGCCCTCACAGGGTATGGAAGTCCACGCTCCGGCAGATCCACAGCTCGGCTACTGCATCGGGAACCAGTC
CCGTGTATCTATCCCTCTTAAGCAGAGAGAGCGATGCATGTGATACAGCCCTGGATGCATTAGGCGGGCTGTGGGCTCAA
GGCTTGTCGTTCAAACTGGAATGGGCATCATCAAGGTTTGCTGAAGCCCTTTGATATTTCGTCTAAGTGCATCGGCTTCC
TCCAGCCGATCGCTTCGATCCAAACATAACTTGAACGAGAGCTAATCTGTTTTTCTCAGCTATGGGGAGAAGCCACGGCA
TCTTGCTGATACTCCATCGTATCCATGGGACCACTCAAGGCGGTACTGGCATGAATCCCACCTATCTAAAGCAAACCGCT
TTCGCTCGCACGGCCGGGAAGACATTATTGGAGCACCGCTAGAAAACTCAACACCCCAGGCTCCTAGTTGGCGAGGTTTT
TTCCGTGTCCAGGAGAACCCTTGGTTGGAAGACCACGTCATCCAGAAGTCGATTTTCTATCCTGCTGGAGGCATGGTGGC
AATGGCTATCGAAGCAGCGAAACAACTATCTGAGTCCAGTCGCACACTGAAGGGCTTTGAAGTCAAGGAGATCTCTATCA
TCAAGCCTATGCTCATTCCAAGATCGCCTCAAGGTCTCGAGAACATGTTCAGCGCCAGACTTCTCGACAAAGACGATGCG
CTCTCTAGCAAGAATTTAACATGCTACGAATTCAGCATTCTGTCAAAGCCAGAAGACAGTCTGTGGATTGTGCATGCCAA
AGGCCGCGTTTCGATCGTGTACGGTGAAGAGTGTCCCGACCCAGACGACTACATCGATCCAGGGCAGACCACCAAAGTAC
AGCGACAAGCGTTCTATCGTGCTCGAGAAGCCTGCGATATCGAACACAGTCCCCGACAGTTTTACGAAGACCTGGACGTT
ATTGGCATGACATATGGCCCACAGTTTCGCAATCTCACTGAGATCCGCACAGACAATACTGCTGCGTATACGGTGATTGA
GATTCCCGATACTAAAGCATGCATGCCATTTCAGTTTGAGTTCGATCATGTCATTCATCCGACTACTCTGGACACCATGA
TTCAAACCGTCCTTGTCCTCAGTGATGGTGTTGGAGAGGCTATGCTTCCTTGCTCGATTGGTCGCATTTACGTCTCTGCA
AGCCTCCCCAAGGGAGCCGGTTCTCAGTTCAGAGGATATACCACTGCCCACAAGACTCACATGCACACAGCCCGTGCAGA
TATCAGCATGTTCGACTACCAGCTTTGTGCGCCCGTTGTAACGATTGAAAACCTCATGCTGAAGTCTGTGCCGAGTTCCG
GGAACGACGGATTCTTACCATCTCACAGAAACCTGTGCTCCGAGATTGTGTGGAAGATGGATATTGGCGCCAACTGCTCT
TTGGGAATTGATCTCCCCGAAAGTTTTCAGGACATGATCGATGCTGCTTCGCACAAGAATCCAGCTTTGTCTATATTATG
CCATGTGCATCCTCTCTATGAGTCTGTTGAAGCTCCGCCAAGCTTTGCAAAACAGCACGTCGCAGCGTCTTACTTCAGCG
GCTTGATCTTCGACGTCCTGACTGTTGGCCATGAGACTCCTCGCTTCTCGCAATTGGTGATATCGGGCTCCGAGCTGCTT
TGGCGGCAGCTGTGCGAGAGCAAGAGGTCCTACCCTGGAGTTGAGCGCGTTCACTCATCCGAGATGCCATCCGCAAATTC
CCAGTTCGATGTCGTCGTTGTCTCTGTTGGCGTTGCAGGTCCCCGCGACATCGACTCGCAGCTTTTCAGGTGTGTTGCAC
CAGATGGCTGGATAATCGTTGTCCCAGAAGAAACTGGCATCTTTTCCACCGAACAACGCACTGAGCTCGCAAACGCAGTT
CATGCAGCCGGGTTCCAGGGCAGCAAAGCACAAAACGACACTTTCCGGTTCTTTGCAGCTCAGAAAAATTCAACGACTGC
CTCTCAAACCACGAGCGAGAATACAATATTACTTGTCCTTCCTGACCAGATGTCAGAACTCACTAAGGCCCTGAGGGATA
CGATACGTCCTATCATCAAAAACAGTTTGTCCTTGGAGATCTTGGAGGTGCCCTTTTCGACGATCTCTTCCCTTTCGAAC
GAGGAGCTGGCTTTTTCTTGCATGTGCCTTGTCGAGCTCGACGCATCCACCATATTTTGCATGAGGGAGGATGAGTATGA
ATCGATTCGCCGTTTATTGATGGTGACGAAGGGGTTGTTGTGGCTCACACGCGGCGCTCAGCTGGGAGCCAAAGATCCTT
CGCGATCTCCATTTCTTGGACTGGCGAGAGCGATTCGGTCCGAGGATGCGAAAAAGAACATCATATCCCTTGACATTGAC
GTTCAGCCCGCCGAGAATCGGATACACAATATGGAGCAGCTCGCGGAAAAAACTGTTCTCCTTCTCAAGCGTGCTTGTTC
TGACCTTCCTCCAGAACCATTTGTTGAGGATGTTGAGTTTGTCTTCTCTGAAGGTCACCTCATGATTCCTCGGCTTATGC
CTTTACCAACTTTAAATCGCCTCATCGAGCATGGCCCTACCATGCCTCAATCGGTTGCCCGAATCCCGCTCACACTTAAG
GACAAGGCCCTGAAGCTCGACAATACCTCAGTTGAAAAACCAAGTGGCCTCCTATTTGTCGAAGACCAAGAGGGACTGCA
CCGGCCGCTGCACCCGGATGAAGTCCGTATTGCTGTTGTGGGCACGAACTTGCTGCCGGAGGACATCGCACTCGCCTCGT
TGGGAGCCCCGAACGCCAAGGTTGGCACAGATGCATTTGGCCACGTCGTAGAGGTTGGAATCAACGTGAAAGACGTTTGG
CCATACTGCCGAGTTGTTGCAAGGATGCGCGACACGATCAAAACCCACGTCATCGCCCACAAGTCGCGAGTTCGTCGAAT
TCTGCACCAAGGTGAATGGCCAGGCAGTTGTCCAACGGCATTCGCAACAGCTTTATATGCACTGAGGACACGCCGGCGGT
CACTCGAAGGAGAAGTAGTCCTCGTTTATGGCGCTTCTTCGGCTTATGGACAGGCTGCGATTTGGATTGCTTTGGCACTT
GGAAACAAAGTTCTGGTAGCCTGCAAGTCCTCGATGGAAAGGAAACTCATGCTAGAGAGCTTCAAGCTTCCAGCAAGCCA
CGTTATAGATGCGCAGTGCTCGGATGTCGAGTTCGAATTACGGATTCTGTCGGCCACTTTCAATCGAGGGGTGGACGTCG
TCTTCGACCCAACCTCAAAGTTTATCGAACAGGCATTTTGTTGCGCTTCCGAGGGTAAGCCTGTGTTGTGAACGTTTCGA
CGATATGCTTTTGAGCGGTTCTTTGACTAACCTATACCTTGTACAACTGCAGGTGGCTGTGTCATACGGGTAGCTTGGGC
AGGTTGCGACGGATCTGCAGTGCGGCTTCCTCTCAAGAACGTGAGCCTCGAGACTGTTGATCTTGGACTTCTTGAGGCTC
GCAATCCCCTCGAAGTAGAGAGACTTTTCTTTGAAGTTGACCAGATCCTCCAGCTTGCCCCTAAGTTGGGTGCCATCAAT
GGAACCTTGGAATACAGAATGAGCCAAGTCCAAGACGCCTTGAAAGCAGCGACGGCCGACCCATTCGCAGGCTCCTACGT
CGTCACCACCCACTCCGACAGCATTCATCCCAATACTGTGAACATACCAGTACCATTGACTCAAACACCAAGACTGTCTC
AATCCTCGACTTACCTCCTCATTGGGGGTCTCGGTGGTTTGGGCCGAGCCATCGCCGAACACCTGGTCACGAATGGCGCG
AGGTGCATTGCATTTTTTTCCAGATCAGGAGGCAGTGCTCCGCCTGCACAAGCTTTCATTGCCAAGCTGAACGCGAAAGG
GGTCTACGCTCGTGCCTTTGCGGTGGACATATGCAATGAAGCGCAACTGGGAACGGCTATCAGAGAACTGTATGGCTCTA
TGCCGCCGATCCAAGGAGCAATTCAATGTGCTGCTGTTGTGACCGTAAGTGCCGAAACATATCTTCTGCATTTTGTATCG
ATAGACAAACGTGCCACTAATACTCCTGAAGGACGCGGCGTTTCCCAACATGGATTATGGATGCTGGAAGCAGTGTTTTG
GCCCAAAGACTATAGGCTCTTACAACCTGCATCAGCTGCTGCCTCGCGCCATGGACTTCTTTGTTTTCTTGTCTAGCTTG
TCTGGCATTATTGGAAACCGAGGACAGGCGAACTATGCGGCAGGAAATAGCTTTCAGGATGCTCTTGCCCGCCATCGCAG
CTCTCAGGGAATGCACAGCGTATCCCTGGATCTTGGTCTCGTTTTGGGAGCTGGCATGGTGGCTGAGGATGAGTCCCTCC
TCGATGCCATGCGAGCCCGAGGGTTTCTAGGCACCAGACTGCAGGACGTTCTCTTCATACTCGACCGGGCAATGGCTAGA
CCCGGAACCGAGAATATTGATATCCCTCCACAGATCGTCACTTCTGTGGGCACTGGGGGTCTCACTATCCAGAACCAGCC
ATCTGACCCGTTTTGGACGCGCGCCGCGTTGTTCCGCTACCTCAATCAAGTTGACGCGCCGCCTCGTGGATTCAATAAAA
TAACGGGCGGTAGCAGTCACAGCGGGGGCAGCGAGAATCTGCGTACGGCGATCCAAAGAACGGCTTCAATGGAGGACGCA
GCATATCTAATATGCACAGCTCTTATTGCAAGCCTGGCCCGGCGCAAAAGTATGGTTCCTTCCGACTTTGATCCTCTCCA
GTCTCTGGACAGCTATGGCATCGACTCGCTCGACTCTTTGTTCATCCTAGGATGGATTTCTCGTGAGACCGGCGTTACAA
TGCAGACAGTGGACGGTTTGACAATTACCCAACTCAGCCAAGCTGTGGCTCAGCGAAGTTTCGAAGCCCTTGAACAGGAC
GCCGTCAGAGGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62