GenePrediction:GLEAN_3013 Details

Name: GLEAN_3013
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:208066..210173 (+ strand)
Length: 2108
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:208066..209296 (+ strand)
Length: 1231
Type: CDS
Source: GLEAN
Position: GCSC_160:209395..210173 (+ strand)
Length: 779
>GLEAN_3013 class=GenePrediction position=GCSC_160:208066..210173 (+ strand)
ATGTTGGACAGCTTTGAAATCGTCACCACCTCGGGCGTGGTTCTCTGGTCGCGCAACTACGCCTTTGTCAGTCCTGCGAT
AGTCAACAAGTTTATCACCGACGTGTTCATCGAAGAGAATGCCTCTGGGGCTGTCACGAAAGAGGAGATCGCCTCGGGCA
GCAGCCATGCACCATACCTGGCCGACCAGTACGCGGTCAAGTGGGCCTTTGTGAAGGACCTGGGCATCATCTTTGTGGCT
GTCTACAAGTCGCTCCTCCACCTGTCGTGGATCGACAAGCTGGTCGAGAACATCAAGACCATCTTTGCCAGCCTGTACGG
CGAACAGCTCACGCGGCCCCACACAACCATCGTCGAGTGCGCGCGCTTCGATAACTACTTTGATCAGCAGATGAACGAGC
TCGAAGGCGGGCCTGCGTCAACGGACACACGACCGCTCAAGACCGATGCAGCTCGACCCAAGGGAGTGCTGACCGACGAT
AACTCGGCCGGGTCCACGCCCATCGACACGCCGGTCACCTCGAGGCCGTCGACGCCCGGCGGCAGCGGCAGCGGCAGCAC
AGATGCAGCGCCTCGCTTTGCCGGCGGCAGTAGCGGCACGACAACATCAGCACAGCCGAGCCCGCTGGCCAAGGTGTCCA
GGCGGGCGCGCAAGGCGCATCACGTGGCCGCTGCCGGTACATCCTACTCGAGCGACGAGGCAGTGCGCAAGCAGCAGAAA
GACAAGACGGCCAAGACGGCCAAGAAGGGACGCAAGTGGGGGGCCGACGGCATGGCAGACGAGGAGGACGACATTCAGCT
GGACTATTCGACGCTGGATGCGGCAGACAAGACGACAGCTGTGCGGTCGTCCGCGCTCGAGCAGGTGGACGCAGCCACAT
GGGGGTCCAAGACGTCCAAAGGACAGTTCGTGCTCAAGGACCTGGACAGCGAGGTACACTCGATCCTGGCGGATGCGGCG
GCCAGCAAGAAGGCGGCGTCGCAGGCCAAAGCTGAGGCTGCGGCCTCGACCTCGGGTGCCGGCGGTCTGTTGGGGTCGGG
GCTGAGTACGATAGGCGGCCTGTTCCGCAACGTGGTCGGCGGCAAGACGCTGACGCGGGAGGACCTCGACAAGGCCATGA
AGGGCATGGAGGACCATCTGCTGCGGAAGAATGTGGCGCGCGAGGCGGCTGTGCGGCTGTGCGAGAGCGTCGAGGCCGAT
CTGGTCGGCGTGAAGACGGGCAATTTCGAAAGTGAGTTTGTTGTCGTTTCTTTCATAATTCTTATGTCGTCTTCTTTTCC
CCCTTTTTTTGCTTCTTTCTTCCTCCTTCCTTCCCTGCTAACATCACAGGTACAAATGCCCGCGTCAAGACGGCCCTTGA
AGCAGCCCTGACAAAAATGCTGACCCCGACATCGTCGCTGGACCTGCTGCGCGAAATCGATGCCGTGACAGCACCACCAG
TCACCTCGCTGCGCAAGCCACGGCCTTACGTGATCTCGATCGTGGGCGTCAACGGCGTGGGCAAGTCGACGAACCTATCC
AAGATCTGCTTCTTCCTACTGCAGAACCGCTACCGCGTGCTGATCGCAGCCGGCGACACGTTCCGGTCCGGCGCTGTCGA
GCAACTGGCTGTGCACGTGCGCAACCTCCAAGAGCTGACCTCACGTGATCAAAACGGCTCCGCCGTCGAGCTCTACCAGC
GCGGTTACGGTAAGGACGCGGCAGCCGTGGCTAAGGATGCCGTCGCCTTTGCCGCCCAGAAGGGCTTCGACGTCGTGCTG
ATCGACACGGCCGGCCGTCGCCACAACGACCAGCGCCTCATGTCGTCGCTCGAGAAGTTTGCCAAGTTCGCCCATCCCGA
CAAGATCCTCATGGTCGGCGAGGCTCTCGTCGGAACCGATTCCGTTGCTCAGGCCCGCAGCTTTAACTCGGCTTTTGGCT
CCAACCGTTCGCTAGACGGCTTCATCATCTCCAAGTGCGACACCGTCGGCGGCATGGTCGGCACTCTCGTCAGCCTCGTC
CACGCCACCAACGTTCCCATCCTCTTTGTCGGCGTCGGCCAGCACTACTCGGACCTACGCAATTTCTCGGTCAAGTGGGC
GGTCGAACGGCTGCTGAGTAACGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62