GenePrediction:GLEAN_3015 Details

Name: GLEAN_3015
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:215931..216607 (+ strand)
Length: 677
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:215931..216190 (+ strand)
Length: 260
Type: CDS
Source: GLEAN
Position: GCSC_160:216457..216607 (+ strand)
Length: 151
>GLEAN_3015 class=GenePrediction position=GCSC_160:215931..216607 (+ strand)
ATGCACGAAGCCCTGTCTCGTGGAACGGTAACAAGTCCTTTGGATCAGCCAGGACACAACAGCGGCCGTAGCATTGCAAG
GGTGTCTGAGCCGGCCTGTCACGGCCTCGTCCCACCTGTACTCCAGACACAGCGAGACGGACGGCCATCCCATCCGCCGT
CCCGTGAGCCTCCGACAACGGAGATGGCGGGCACTAGGCGCATGCGAGCGGCAAAGCACAACTCTAAAGGAGTGACAGCA
GACGGCTACGCACAGCTCAGGTGCCTAGCCCACATGCAATGTCGTGCCGCCTCGTTCGGAGCTTTTATCTTGCCGTGGCC
CAGCCTGTAGCACCCTCACACCGTTGAGACGTCAGCTCTACAATGCGACTTGCATGATCTTTGGCCGTCTGAGAGGCACC
GCATCGTTTCTGCTCCGACAGGTGCGAATGCACCATCGTCGTCATCGTCGTTTGTCGTCGTCAGCATGTGCGAGCCTGAC
GGATTGTGTCGTGTAGGACAAGAGGATAACGGCCCAATGCATCCAGACAAGATCCCACCTCTCTGGCTGCCACATCTCTC
GCCGTCTTGGCTCCGGAAGCAGACGGCTGTGCCTCCCGGCGCCTGGATCCCGGCTTCTCGCAGCTGGCGTCCAAGAGCAG
CAACAGACAGCCGATCGCCAGGTCAGAGCAGACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62