GenePrediction:GLEAN_3016 Details

Name: GLEAN_3016
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:231072..235070 (+ strand)
Length: 3999
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:231072..231865 (+ strand)
Length: 794
Type: CDS
Source: GLEAN
Position: GCSC_160:231929..235070 (+ strand)
Length: 3142
>GLEAN_3016 class=GenePrediction position=GCSC_160:231072..235070 (+ strand)
ATGGGGAACACGCCTTCCACCGAGGCAACCCGGAAGTCGCTTCCTTCTCGTCCGACCTTCCAGCCACAGCCACCACTTCC
TATCGCCATCACTTCTGCCTCTCCTTCCTGCCCCAATAAGCTGTCAAAGCCCCGTACACGTCGGCGGTCAACAATCAGTC
GGGCACGAACTTCCGATGACCTTGCGAGTAGTGTTGGCTCCAATCATGCACGCTTTACGACCTCTGGGCCCGGCCTCGTC
TCTGCCTTCTCTACTTCCCAACCCCCGCCATCCTTGCAACTGGACGGTTTTCGGCCGCCTCATCACCTCGTATTGCCGGC
CTCACCGCCGGCTATCGGCTCGTCTGCGTTTGCTTACGAGCAACCCGTTGCACCTGCAATTAGCCGACGGGCCTCTGGCT
ATTGGCAGGCTATGCCCTCTGTATATTCGACTCCCGATGCAGAGCTTGACGTTGCATTTTTCCAGGAGTACCAACAACAA
CAGCAGGACCTCCAACTGCAGCAGTGGAAGCATCATTTCGACCCCCAACACAGCGAGCAGTCCTACCCAGACGACGAGGA
ACAGTTTTCGCGGAATCCAAGACTGAAACCCAAGTCACGCAAGCGAAGTAGCTTGTTTCGATCACGGTCCTCACGCCGAC
CGGCTGAGCCGCAGGACGAGCAAAATTTTCGCCGACGGAACAGCATTAGCCAGGAAAACCCATCTACTGGCGATTGGCAC
CATACATGGGATGGTGGCCCTATGACATACGAACAGGCCCTGAGCCAGTATTACGGTGGAAGAATCCCCGATAGGTTAGT
GGTTCTTTCACGCGCCTTTACTTGCCCTGTCCCTGGCACTGACTTTATTTCCTGTAGTTGGCCACTCCCGGTCAATCCAC
GAGCCTCGTGGAATTACGACCTCTCGTCATATGAAGCCAAGCGGCTACTCCACATTGTGGATGGCGACCTTTCTTTCGAC
CACGGGCTCGAGCAGACTACAGTTGCCTCTGAAAGCAGGGAGCCAGTTGTGTCGGAGGTGACTTGGAAGAGCTCTCATCC
CGTCCAGGATGGAAGCCGAGGTCTTAGCCGGGCCAACTCCGATATCTCCATGTATGCACCAGTTCGCCGTCGCTCTATAG
TGCAGGTTCCTGGTGTTGCTACTCGCAGAAGCAGCAGCAGCAGCATTTTCGCCGGCGGTGTTACAATGACTCAACAAAGA
TTTCGACACAGTGTTTCCACCACACCCAGTCTCTCCCACCAGACCTCTTTTGAGTCTACAGCCCACCGCGTATTGTCTAT
GCCGCCAATGTCGGCGCTACCAGCAATTCCAATACTGTTCCGTCTGCCTGGCTCAAACGACGACACTGAACCTACACCTC
GGGTGACGACACCTTGCGACAAGGACTACCAGGCTATAGGTGCCTTCAAACTGGGCTCTTTGCGAATCACCAACGGCACT
GCTAGCCCCGTGCCCTCACTGGAGCGACCGAGGACGCGTGAGGTAGACACGAACAAGGAAAAGCCTATCAGCCGTGCTCT
CACATTCGATAAGAAGCCCTCCAAAAGCCAGATTCGCCCAGACAACGGAAAGAACGACCTTCAACCATTTCCCCCGTACG
CAGAGCAGTCGTCGGAACCTCTGGCTGAAATAGACACCCGTCCATTCAGCGGATATACCATTTCCAAGAATATCCCTGGT
AGCGATTTGCCACAAATCGCACTTTCTGACGAAGTTTTTTCCGGGTTCGTGTTCGACTTGTATCCGCTAGACGATGATCC
GTCCCCTCTCAGACTACAGACAACATCGAAGAATACAGCCATGGAGGATGATCTCTTTGAAAGCGAGAGCGATACGCCTG
AATATCTGCCCGACGAAATCCTGGACGTTCGTCTTGACCTCAATGCGAAGTCTGCTGGCAGCAGCGGCTACGCCACGGCC
GTCCTCGCTGACGGCAAGACTGCCCAAGGCGCTCATATCGTCTCCCGGTCAGACAGTGGCTTTGTTTTGAGTCCCGCAAA
GAAAGCAGCAAATAAGCCGCTCTGCAAGGCCGATTCGGGCTACAGCTCCAACATGTCCATGCGGTCCTTCAAGCAAGCCG
CCTCAAACTTCATGAGTCCTCGTCGTGATTCCTTCTACATTGCCGAGCCAAAATTACCAGATCTGAACGCCGATGCCTGC
CCATCGGATGCCCAAGCTCCCAATGCCAACCATGTTACTCTCACCGTCCCGAACTTTATTGTCTCCCCATCGCCATCGCG
CTCGTTTCCCTCCGTTCTTTCAAACGACACGCCACTGGTCTCACCGGCGAGCACAGCAGATGCGAACCCATCCTCCACTG
GAGCCACGATTGCACTTCCAGCCATTTCCCACTCGACTGGCACCATGGCTGCTGAGCTAGGTAGTCCTGTTTTTCATAAC
ACCAGACTCACAGGCCCACAGCTCGGCCTTTCCAAGAAACGGCACAATACCCCAACCTCTCTAGAGGTACTCCGGTCTCC
AGTACGCGCAAACAGCTATCCGACCCTAGGCACCAGTCCTTTTCCAATTACACCGCTCAGCGCCAAGTCTGGTGGCTCGA
AATCGGCCTCGAGTAGTGTGAGTGGCACTCAACGGTCCAGCAAACTACGCCGGCTATTCAACCGCGGAGCAGCGGCTTAC
AAGGGCGCACAGACTGGGGCCGACGCTCCGTCCGTTTCCCAGGATATGCAGACCAAGCTGTCCGATCCCGCAGACTTGTC
TCCGTTGGCAGCGAGACGGGTGGCAATGAAGAGAAAAGTGAGCAAAGATACACTGAAAACAATTCTCAGTGTGGGCAGTC
TCGAAGCGTGCAGCGCCCTCGAAGTACAGGCAAACGGACCGGTGGGGAGTATGCCGCCTACCACGTCCAAACTGCCAGGC
GTCACCGGAGAGAACAGAGATCAATCTAGACGGCGGCCTTTGGGCCGGCGCCATACGTTTCAGAATGTTCCATCATCACT
GGCTCACGCGGCGGCGTCTGTGATGTCCCCGCGGAAAGCCGCGCATAGGAAATCTGCACTTGAAGGGACAGTGCTCGAGC
CGATTGAGAATACGGGAAGCGCTGAAAGGAGCAGAAAGAGCAGAGAACATGGGAGAGGTACGAAAGCAAGGCAGACAGAG
AAGCTGAGGGAGAAGACATCGCGTGGATTCCAGAAGCCGACCGAAATGCCCTCGCTGATAAAGGCCTTTGGAGCCGAAGC
GAGTCTGGCGGATCGAAATACCCCCAACAGACGAGCGAATGGATCCAGCGCAACTTCCACAGCCATGAGCGAGGCGCAAC
ATGATCCTCTGGCTACCCCATCTAGCCTTCGAAGCCGAACGATGAGCCTGACGGCCCAGCTTGAACGCAATTTCAACATG
AAACTGCCCTTTTCTCGATCTTCGAGGCCGACTACTGCAGACGCAGAAGAAGAGAAACAACAGACTAGCGCCAAGCTTCC
GGTGACTATATCGAACCCGATTTTGTCATCGTCGGCCCCCGAATCCTCCGTACGAGCCTCTGCAAGACTCGTGCAAGCCG
AGCATGGCTACAGCAACGGGCCAAGACGCGAAGGACAGTCGGCCCGTGTGCATGGGCGCTGCAAATCGAAGTTCTCGGCT
CACAACCTCACCAGCCTGGATCACAAAGCTTCTTCCAGTAGTCACCCACGGATGGCCGCACAGCCGCTGTCCCCATATTC
CCTAAATGCTACATCGCCGTACGAGTTGCGACACCGAGCTAGCTGCGACGACTACAGCAATGTGCCGACCAGCAATGGCC
GCTGGCGTAGCGGAAGTGACGGTACCGACGACAATCGTTTCCAGCAGCAGCAGAACCACCAGCAAAAGGCCTGGGACCAC
TACTACCGGCAACACGGCAGTCAGCTGCCTCCGTCCTCACCTCGTGGCTACCACTATCGCAACCAAAGCACAGGCTCACG
CGGCGGCACCCAGGCGCCATATCGCATCCTGCACAGCTACAACTCGCCAGCCTATCGCAACGCGCCCATCTGGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62