GenePrediction:GLEAN_3018 Details

Name: GLEAN_3018
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:242409..250024 (+ strand)
Length: 7616
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:242409..242921 (+ strand)
Length: 513
Type: CDS
Source: GLEAN
Position: GCSC_160:243006..249434 (+ strand)
Length: 6429
Type: CDS
Source: GLEAN
Position: GCSC_160:249485..250024 (+ strand)
Length: 540
>GLEAN_3018 class=GenePrediction position=GCSC_160:242409..250024 (+ strand)
ATGGTGGCCGGCACCCCCGGCTTCTCGGCGCAGACGCGCGGGAATCCTTTCGCGAGGAACACCCAGGCCGGCTCACCCGG
CCAGAATGGCGTCTCGGCCAGACCCAAGTCGGTCCTCTTCAACACATTGCCGGCCACACCGGCCCACGGCAACACTCCAC
CGCCTGCTCCACCACACAGCCGATCCCAGTCCGTCGCCTCACTATCCGGGCTATCAGGCCTGCCAGGGCTCAGCGGGCTC
AACGGGCTCGTGCGGGCCGGCAGCGTGTCACGCCATGGCTACAGTCAGTCTCGCGATAACACGCCCGCATCTAGCACGTT
CGCGCCGTCGTTCATCAAGACCGAGGAGATGAAGCAGCGGAGCATCGACGTGGTTCGCGGCATCGAGGGCGAAAACGACT
TTTCGGGCAAGCGCTATGTCTGGCTGAAGGACCCCCAGGTGGCCTTTGTCAAGGGCTGGGTGGTCGAGGAGCTCGAGGAC
CACCGGATCCTCGTCCAGTGCGAAGACGGCACCGTATGTATCGCTGCCCGCAAGAAGACGAAACCCCTGGAAAAAAAACC
CCGAGCAAAAGACAAGCAAAACTGACAAACTGCCCAGCAACGAGACGTCGATGCCGAGAGCGTCGACCGGGTCAACCCGG
CGAAATTCGATAAGGCGAACGACATGGCAGAGCTGACACACCTCAACGAGGCGTCAGTGGTGCACAACCTGCACATGCGG
TACCAGGCCGACCTCATCTACACATATTCGGGGCTCTTCCTCGTGACGGTCAATCCGTACTGCCCACTGCCGATATACAC
CAACGAGTACGTCAACATGTACAAGGGCCGTAACCGGGACGACACCAAGCCGCACATCTTCGCCATGGCCGACGAGGCGT
TCCGCAATCTCGTCGACGAGGGCGAGAACCAAAGCATCCTGGTGACGGGCGAATCTGGAGCCGGAAAGACGGAAAACACG
AAAAAAGTGATCCAGTATCTGGCTGCAGTGGCCCACACGGACCAGTCGGCCGCCAAGAACCGCGGCAATCCGCAGCATGC
GCACCTCTCGGCCCAGATCCTGCGTGCCAACCCGATCCTCGAGGCGTTTGGTAACGCGCAGACGGTGCGGAACAACAACT
CGTCTCGCTTCGGCAAGTTCATCCGCATTGAGTTTACGCCCAACGGGTCTATTGCCGGGGCCTTTATCGACTGGTATCTG
CTGGAAAAGTCGCGTGTGGTGCGCATCAGCGCCCACGAGCGCAACTACCACATCTTCTACCAGCTGCTCAAGGGAGCCGA
CAGCCGGCTGCGCCGTGAGCTCCTGCTGGACGACATGGGCGTGGAGGACTTTGCCTACACACGTGACGGCAATGACGTCA
TCACTGGAGTCTCAGACGTGCACGAGTGGGAATCGCTGATGGAGGCCTTTGGCGTCATGGGCTTCACGGAAGAAGACCAG
ACGGCGATCCTGCGGACAGTGGCAGCCGTACTACACCTGGGCAACATTTCGGTCGTCAAGGAGAGCCGGGCGGCCGACCA
GGCACGGCTGGCCACGGACTCGACCGCCCAGGCCGAACGTCTCTGCAGGCTGCTGGGCGTGCCGGTCGAACCGTTCCTCA
AGGGCCTGCTGCACCCACGGGTCAAGGCAGGCCGCGAATGGGTTGAGAAGGTGCAGACGCCCGATCAGGTGCGGTTGGCC
ATCAACGCGCTGGCCAAGGGCATCTACGAGCGCGGGTTCGGAGACCTGGTGTCGCGCATCAACCAGCAGCTCGACCGGGC
CGGGCTGATGGGCATGGACGATGCGCACTTTATCGGCGTGCTGGACATTGCCGGGTTCGAGATCTTTGAGGAGAACAGCT
TCGAGCAGCTGTGCATCAACTACACCAACGAGAAGCTGCAGCAGTTCTTCAATCACCACATGTTTGTGCTCGAGCAGGAG
GAATATGCGCGCGAGCAGATCGAGTGGCAGTTTATCGACTTTGGGCGGGACCTGCAGCCGACGATTGACCTGATCGAGCT
GCCGAACCCGATCGGCATCTTCTCGTGTCTGGACGAGGACTGTGTGATGCCCAAGGCGTCGGACAAGTCCTTCACCGAGA
AGTTGCACTCGCTCTGGGACAAGAAGTCGCCCAAATACCGGCCGGCACGACTGCGGTCGGGCTTCATCCTGACGCACTAC
GCAGCCGAGGTGGAATACTCGACCGACGACTGGCTGGAGAAGAACAAGGACCCGCTCAACGACAACGTAACGCGGCTACT
GGCGACGTCGACGGACAAACACGTGGCTCGGCTCTTTGCCGACTGCGCGGCCGACCAGGACGACGACCATTCGGTGGCCG
GGCGCAGCAGCCGGGTCAAGAAGGGCCTCTTCCGCACAGTAGCCCAACGCCACAAGGAGCAGCTCGCAAAACTGATGGCC
CAGTTGCACTCGACGCATCCGCACTTTGTGCGGTGCATTCTGCCCAACCACAAGAAGCGGGCCAAGCAGTTCAACAGCCT
GCTGGTGCTGGACCAGCTGCGGTGCAACGGTGTGCTCGAGGGCATCCGCATCGCGCGTACCGGCTTCCCCAACCGTCTGT
CCTTTGCCGAGTTCCGCCAGCGTTACGAGGTCCTCTGCCGCGACATGCCCAAGGGCTGCTACCTCGAAGGCCAGGCGGCA
GCAGCCATGATCCTCGACAAGCTCGGGCTCGACCGGGCGCTCTTCCGCGTCGGCCTGACCAAGGTCTTCTTCCGGGCCGG
CGTACTGGCCGAGCTGGAAGAGCAGCGCGATGCTCTGATCAACGAGATCATGTCGCGGTTCCAGGCGGTCGCACGCGGCT
TTAGCCAGCGGCGCATCGCTTACAAGCGGCTGTACCGGGCAGAGGCGACGCACGTGATCCAACGCAACTTCCACGCGTAT
CTCGATCTGTCGGGCAATCCATGGTGGCAGCTGCTGGTGAAGATGCGGCCGCTGTTGGGCGACTCGCGGACGGCGACCGA
GGTGCGACGCCGGGACGACGCCATCCGGCAGCTGCAGGGCCAGGTGCAGCAGCACGAGGCCGGGCGGCAGAAGCTGGAAG
AAGACCGACGCATCGCCATGTCGGAGATGGCTCGGATCCAGCAGACACTCGAGAGCGAGCGGGCACTGGCGCTGGACAAG
GAGGAGATCTTCAAGCGGCTACAGCTGCGCGAGGCCGAGCTGGAAGACAAGCTTGCGGGCGCTATCGACGACCAGGAGCG
ACTGGAAGACCAGCTGGACGACCTGCTCGAGGTCAAGAAGCGGGCCGAAGAGGACGTTGACAAGCTGCGGGCGCAGCTGG
AGCAGGCGGCCGGCCTGATCGGCCGGCTAGAGGAGGAGAAGACGCGGCTGGCGCAGCGGGTGGCCGAGCTCAACAGCAGC
CTCGAGGAGGTGTCGCGCCGGCAGTCGGAGCGCAGTGCCCAAGAGGTGGCGCTGGCCGAAGAGATCAAGATGCTGCAAAG
TCAGCTGTCGATCAAGGAGCGCAAGTCACGCGACCTGGAGACGCGCATGCTGCAGGTGGACCAGGACGCGGCCGTCAAGG
TAGCGACGGCGGAGAAGGAGCTGCACACGGCACGGACAAAGGAGCAGCGGCTCGCAGCCGACCACCAGGACGCGCAGAAG
CGGCTGGCCCAGCTGTCGCAGACGTCGACCGACTACGAGGATCTGATGCGGCAGAAGGAGAGCGAGCTGGCGCTGCTGCG
TAGCGACAACAAGAAGTACGAGGCCGAGCGGCGCTCACTCGAGGAGCAGCGACAGATGCTGGGCAGCGAAAAGGACAAGG
CCACGGCCCGACTGCGCGAGGTGCAGGCCGAGATCGAGGCGATGCGGTCGCAGGAGGACCAGCTGCGGCGCGAGGCCAAG
GACGCTAAGGAGCTGCTCGAGGCACGACTCTCAGAGGATGCGCAGGCTGATCAGAACCGGCGGTTGCTCGAGTCGCAGAT
CCAGGACCTCAAGGAGTCGTTGTTCGCGACGCAGAAGGAGCTCAGCCGTGAGCGGCAGTCACGTGACGACGTACAGCTCA
TCGGCGAGCACAAGTACCAGGCGCTCAAAGAGGAGTACGACCACCTGAACGAGTCCAAGATCATCATCGAGAAGGAGCTG
TATGCGCAGCAGGACACGCTGCGGCGGACGATGGAGGCGCGCAAGGTGATTGAGAAGGAGCGCGACGACGCACGCCAAGA
GGTGCGGCGGCTGCGCGAGGCCAAGGTCGAAGCGGAAGAGGCACGGATCGAGGCGGAATCATCGGGCGAGCGAGCAGCAT
TGCGACTGGCACGCGAGCGTGAGGAGAGCCTGGTGCGTGACCTGGACGCGGCGTCGGAACGGCTGCAGTGGTTCGAGACA
GAGCGCGACCGGCTCGGCAAAGAGGTCGACGAGCTCAACAAGCTGATCGTCTCGTCGGGCGAATTCGGCCTGAAGAACGA
CCAGGCCAAGGAGCGCATGGAGCGCGAGCTGAACACGATCAAGAGCCGGCTGACCGCGTCGGAGAACGACAACCGGGCCC
TGCTGAACAAGCTGCAGCAGAAGAGCCTGGACATTGCACGGTCGAGTTCGCGGGCGAGCGAGGCATCCCGTGGCCAGATC
CAGGTGCTGCAGCGCGAAAAGGCCCGGCTGGATGAGCAGGGCACCAAGCTAAACAAGCAGCTAGGCGAGGCCCAGATGAC
CGCGGCCGCGCTCGAGAAGAAGGTCGAGAAGCTGAACCTGACGCTGGAGGACATGAACCACGAGCTGGCCCGCGAGGTCA
AGGCCAGCCGCACGGCCGAAAAGGTGTCGGCCAACGCGACCTCACAGCTGGCTGAGGTCAACCGGGCCGTCGAGTCGGAG
CGCCACCTGCGCGGCCAGGCCCAAAGCACGCTGCGCACTGTGCAAGCCACGCTCGAATCACGTGATCGTGAGCTGTCGGA
CGTGCGATCACAGATTCTCAGCATCCTCAAGACGGTCGATCCGGTCGCTGCAGCCGCCTCCTCGGCCGCCGTCTCGGCCG
CCAACGATGGCAGCAGCGGCAGCGCCAAAGACCGCTCGCTGACGAGCAAGGACTTTTTCGATCTCGGCCGCAAGATCGAG
GAGCTGCAGCAGGACCTGCGCGTCCAAAAAGCCGGTCGCAGCAATGCCGAAGCCCAGCTGGCCGAGCTGCGGGCCCAACA
GCAGTCGCCCGTGCTGCAGCGGTCGCGGCTGGAAGAGATCGACCCCAACGAGATGGCCTATCCGGCGCCCGACGGCTCGC
CCACCCGGACGAAGAAAGGCCGAGGCGGCGCCCGTCGCCTCTCCAACGGCGACAAGAGCAACGGCAACAACAACGGCAAC
AACAACAGCAACGGCATGGCGACGCCGCCTCGGCAGATGTCGGTCATGCCGGACTCGGCTCGCTCCGACCGCACGGTCGA
CATGCTGACGATGAACAGCCGGATGGACCTCAAGGCCGAGCTGGAAGAGGTGCAGAACCAGCTACAGCTAGCACAGATGC
AAAATCGCCACCTCCAGAGCCAGCTCGAGCGCACCAGCGGCGGCAGCGGCGACGCGGCCAAGGACGACCAGGCCGACAGC
AGCAGCAGCAGCGGCGGCAGCGGGCGCAACGGGCGGATGCAGAAGCTGGAGAAGGCTAACAGCCGGTTGCACGACCTGCT
GGACGACTCGTCCAAGAAGGTGTCGGCGCTGGAGAAGGCGCTGCGGTCGGGCGAGCTGTCGCTGCACGACATCCAGACAC
GGTCGCACGAAGAGATCCTCGACCTGTTGAATGGCCAGGAAGAGTCGCGACGGTCGCTGCTGCACAGCCACAACGACGTG
GTAGCCGAGCTGACCGACACCAAGGAACACTATGACAAGCTGCGCTACGACCGGGCGCAGATGGAGGTCGACCTGCGCGA
CGCCCGGTCGGAGCTGGAGGAGATGGAGCAGGCGCGCGAGCAGGAGGCCGAGAGCCGCAGCCAGCTGCTGCAGGAGTTCT
CGGACCTGCAGATCCGGCTAGACGCCGAGACGTCCAAGCTGACGGACGTGACGTCGAGCCTGGGCCTGTACAAGAGCCGG
GCCGAGGAGTACTTTAGCAAGCTAGAGCAGGCGGAGATGGCGGTGATCAAGGCGTCGCGAGCCGAACAGTTTGCACGCAC
GCAGGCACGCGAGGCCGAGGAGACGTATGCCGAGGTGATGGCCGAGCGCAAGCAGATGGACAACATGGTGGAGGACCTGC
AGCGTCAGAACCAGCGGCTCGAGGAGCGGCTCGAAGACGTGTCGACCGACCTGGAGGCCGCCACCCAGGCCCGCAAGCGG
TTGCAGCACGAGCTCGAAGACTACCGCAGCCAACGGGCCATGGACATTGAGGACACCGAGACCAGCCTGGAACAGACACG
CCGCAAGTACCAGGCCGAGTTTGCCACGCTGACCAAAGAGCTGGACCTGGCGCGCGAGGAGAAGCTGTTCAAGCAGGCCG
AGATCGGACGCCTGCGCGAGGAGCTGGACGAGCTGCGGTCCAAGTGGGACGACGAGGTGCTCAACAGCTCGACCTGGGCC
AAGGAGAAGACGCGGCTCGAGAGCACGCTGTCGGATGTGGTGGCGTCACGTGATGAGGCTGTGCAAGCCCACAATGAGGC
GCAGGGCCGCATCGTCAGTCTGTTGTCCCAGGTGCACACGCTGCGCACGGCCGTCGACGAGACGACGTCGGAGCGCGATG
CCCTGGTGCGCGAGAAGCGCAGTGTCGAGGCGCGGCTGAACGAGGCCAAGTCGGGCCTGGAGGAGCTGGCCGCCCGCGGC
GCCAATCCGTCGCTGCGCAGCGCCGCCCACGCCGACAAAGAGATGCTGGATCTGCGGTCGAGCCTGGCCCAGCAGGAGGA
CGTGGCCGCGGCCGCGGTCGAGAAGATGCGGCGGGCCGAGGCGCTGGCGGCCGAGGTTCAGAAGGACATGGCCACGGAGC
GCGAGGCCAACAAGAAGCTGCAGGCCGACAACGCCGTGCTGGAGAAGTCGTTGAGCGAGGTGCAGGTCAAGATTGTCGAC
CTGGAGACCAAGGGCTTCTCGAGCGCGAGCCAGGACATCAAGTTCCTGAACAAGCGAATCCAAGAGGTAAGCAGTCCTGC
TCCTTGTCCGTTGCCTGTCCATGCTGACCGTCATAGCTCGAGGCCCAGCTGGAGACCCACGAGAAGGAACAGGCACAGTC
GCAGCGATCGGTCCGCAACGTCGATCGGGCCGTCAAGGATCTGCAGGGCCAGCTAGACCGCAAGGAAAAGCAGAACCAGC
AGCTGCAGGACGACGTGGTGCGCATGCGCGACAAGGCCGACAAGCTGCTCAAGACCATCGACGAGCTGCAGTCGTCCGAG
TCCAACATCCAGCTGGCTGCTCGGCGGGCCGAGCGTGAGCTGCGCGAGGAGCGCGAGAAGAATTTGCGCATGGAGCGCGA
GCTGGAGAATTGGAAGGGCAGCAGCAGCAGCAGTGCTGGCAGCAGTGCTGGCAGCATGCGGCGCACCGGTGCACAGGGTG
CTTTCCGCGCCTCCGTTCTCGGCCATACGGCCTCCACTGCCACCATGCGCACCACCGTCTCGACCGTGGCCTCGTCCATC
GATGAGGCCTCCGAGGCCGGCAGCGTCGACATGCCCAAGCGGAAGGGCAGCGTCGGCCTTGCGCGAGCCCCGAGCTTGAC
CAAGGGTTTTTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62