GenePrediction:GLEAN_3019 Details

Name: GLEAN_3019
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:251076..252511 (+ strand)
Length: 1436
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:251076..251609 (+ strand)
Length: 534
Type: CDS
Source: GLEAN
Position: GCSC_160:251672..251738 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_160:251976..252511 (+ strand)
Length: 536
>GLEAN_3019 class=GenePrediction position=GCSC_160:251076..252511 (+ strand)
ATGGCAGAACAGCCCGACCAACAGCCCGTTCAGGGTCCCGACCAACAAGCCGGCCAACAGGCCAACGAGCAACCCGTCCG
ACAGCCTGTCCAGCAGCCCAGCCCGCAGGGAGGAATCCGGCAGGCCATCCACCATGCAGTGCAGGAAGCCGTGCAGCGGG
CCGTACTATGCGCAGTGGAAGAAGCCGTGCGATCTTTGGGACAAGAAGACCTAGGGGGCCAACAGCTTGGATACGAAAAC
TACGCTGACTGGTACTACAACAACCAGCAATATGCTCAGCAGTATGCTGGGGGACAATATGCCGAAGGAGGGGCAGGTTT
TGATCAGGCGGCCGTCGACGAGGTCGTGGCAGATCCTAGCATGGAAGAGCCCCTTCGAAAGAATAGGAAGACGTGTGACC
GCCGCGGCTGCCAGGGCTGCAACAGCGCCGATTGCAAGAGGCGCTCGCTCAGATGGCACAAGCCAGGGCCACATTGGTGC
GACGGCAAGGGCTGGGGTGGGAAGATCTGGGGAGTGACCCGCAAGCCAAGTGATGTGAGCCCTATCTGTCTCCTCGACTC
TCTTACTGTCGCTAATATGGCCCACTCTTGCCACAGAAAGACATCCGGCACTGGGACATGGTCTTCGACCCCAAGCTTAC
GAGGGAGGAGACGAAGGCAATCCGTAATCAGAGGTGTCCGCCGCCATGGCGATGCATACGATATGATTACAGTGATAGCG
ACTACAGCAGCGATCACATCGGCGACTACAGCGGAGACTACAACGGAGACTACAACCATATCTACCACGGCAACTACAAT
GGCAACTATGGAAACTATGGCAACTATGGCAACTACAATGGCGTTTACGCTGGTGAACGAGGCCCAGTTGCAAACATTGT
AGATATTGTACCACCCGCAGGCATCGCCGAGCATTTCCGGATACCGGACAATGCCAGCAGCAGTAGAGGCGGGGAGAAAG
GCTCAGTGGGGGGAAGCAGTTCCGGAGCCAGCAAAGGTAAGGCTGTGTCTAGAGGCAGGCCTAGATCTCAGCCGTCCGAG
TCCAGTGACAATCGGCGAAGGCGAGACGATAAAGGCACCCTCCGGTCGGGCTCGTGGGAACGCGTCTCACCGACAGAGGC
AGCCAGGCGTGACCGCATGCATGCTAACGTGCAGATGTCAGGGGCAGCCGCGCCAGGATCTGATGCTAGCCAGCTCAGAT
CGGCTGCAGCCGCACCGACCGTCCTCCGTTCGACGGTAGAGGACGTGGCCGCTCAATTCGACGACTCCTACTACCTCGAC
TGGCTGGCCATGCGCCGGAGCATCTCCAACCCGCCGTCAGTCCGAGGTCAGCGCACGAAAGCCGCCGACACGGCGTCCGA
CCTGAAGGATGGCAGGAAACATCATGACAGCTGCAATGGTCGCCACAGCCGTCGCCACGGCAGACGGAACAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62