GenePrediction:GLEAN_301 Details

Name: GLEAN_301
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:898460..904761 (+ strand)
Length: 6302
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:898460..899282 (+ strand)
Length: 823
Type: CDS
Source: GLEAN
Position: GCSC_167:899993..902154 (+ strand)
Length: 2162
Type: CDS
Source: GLEAN
Position: GCSC_167:902502..902720 (+ strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_167:903227..903796 (+ strand)
Length: 570
Type: CDS
Source: GLEAN
Position: GCSC_167:903856..904761 (+ strand)
Length: 906
>GLEAN_301 class=GenePrediction position=GCSC_167:898460..904761 (+ strand)
ATGACGTTGGGATGCTATATGCTGGTAGCTACTCTCATGTATAATGTGCACATGGGACCCAACGGACTTCACCTACCCGG
AGTCACAGTAACCGGATGGTTATTTATTGCACTGGCGGCCGTCATCTTGGTCGGCGTACATGGCAAGTACACGCTCCAGT
ACTTACCATCAGTCTTGATCTTTTTCTCCATCGCCGTTCTACTGCACAACCAGATGTGGCCTTACAACAAAGATTTTGGG
TATGTGTGGTTCATTGCCTGGATCGTCCTCTACAAGTCTATCACCTTGGTCTTTGCACCATACATCGTGTTCCAGCCGGT
CATTTGGTATAGCTCTTGGGTGGTCATTGTTGCCATGCTCGGCTGGGCATTCCGGCCCGACCAGTCATTAACCCGCTTTA
TGCTCTGGGCGGCCACGATTTACGTTTTGCGGAGTGTGCTATTTTTAATAGTCCTTACATACTTTCCGGGGGACAACAGA
AGAGCTTCATTGTTTCCCTTCAATCTATTCAGTGGCACGTGGCGGGTGAGCCGCGAACGATGGCTGGCTCTTGTCGAACT
GCCCAAGGAAAACCCCGAGCAAGTACCCGGGGGCGACTCCGGGCAATTTCCAGAAAACGAATCCGAGCGGCGAGCATTAT
GCGAGCGATGCAACATTATTGTAGCCAGCTCAAAACTGATCACAGGCTCGGAAACGTACTTGACCCGACTTACCGAATGG
CACGAATTTCGGACGACGAAAGAGTTCGTCGACAGTTTTGCAAAGCCTGAACAAAATACCAACTCGGCTACTCAAGAAGC
TAAACCAGCAGAGGAGGCCGTTGGTAATTTGGCAGATCCCAGACAAACCTCTAACTCAGCTACTGAAACCCTTACACTGC
CGAAAGACTGCCATCTCTGCTGCCTTCTATGGTACTCTATGAGTCCGCCACGCCAGCAGGATATTGCCAAGAGCTGTATG
CAGACAGGCACTACCGTTGCAGTGTCAGAAACCCAACGTCAAGATGCTGCGCCGCCTAGGTGCCAGCAAGATACCTCCGA
GGGCTGCACGCAGACAGGTAATACTGTTGCACTGTCAGAATACCAACGTCAGGACGATACGCCGTCTGGACACCGGCAGG
ATGTTGCCGAGAGCTGCAGCCAGGTAGGCAGTACCGCCACGCTATCAGAAAATCAACCTCGGGACGATGTGCCGTCTGGG
TGCCAGAAAAATGGATCTGAGAGCTGCAAACAGATAAACAATCCCGTTGCAACGTCAGGGAAAAAAACTCAGGACGATAC
GCCATTTGAGGTAATTCCGCTCTCGAGACCGACGAATCCTTCTGCCGGGTTGCGAATCAAAGTATGGGAAGAGCGGCCGC
TGACGCCTTACACATATACGCAACTATATTGGGGCGATGTTGCTATTGGGTCTCGGCTTCTGGTACACAGAGGCAACCTC
CTTCCTACCCGTGAGTTTTAGACCAGAATCTCTACCTCTACATAAGGGGAGCCTGTCATCCGGATTTTAGCCTAACCGCT
TTACCACATGCAGAATCGCCATCCATTGAGCAGGATAATACGGGCTCTAAAGCGCACTTTGAGCAGGCTTTAGAATGGCT
TCAGTCATGCCGTGAAAGTCACGACCTGTGCAAAGGTGTCGGCAATTCGAAGCCCGTCCGACCAAAACGAATGCTGTTTG
TCTCTAATGGCGGGGAAAACTACTTGGAGCCGGGGATGCCACCTGCATCCATCAAGCTCATGGACACCTGCGACATCGAC
TTTACTAAGTCTGAATACGTGGCCCTTAGTCACTGCTGGGGTAAGACGAAAGAGGTTCCCTTCACACTGCTGGCGAGCAA
CATTGAAATGCTCTACCAGGGAATTGACTTCTTCTGTCTGTCGCGGAACCTGCAAGATGCAATTACTGCGACACTGAACC
TTGGCTTCTCGTATATCTGGATCGACTCTTTGTGCATCACACAATCGGATAAAACCTTTCAGGAGAAGGAAGAGCTGGCC
CACATATGGGAGGAAGACTGGAAAAATGAGGCGCCGAAGCTGGGCGGCGTCTACTCAGCCGCCGCCTGCACGATTGCATC
TACTGGGTCGTTTGACTGTAACGGTGGCTGTTTCCATTCCCGGAATGTGAAGGCACTCGAGCCGTGCAAGATTGGAGCCA
AACCTGGGATCAAACCCACTGCAGCGACGCCTGACGAAGTGATCTATGTGCGTCGTGATGACGTGTTCGACTTTGATCGT
GGCGTCAACTTGGCACCACTTAACACTCGCGGCTGGGTCATGCAGGAACGTCTTCTGTCGCGCCGCATCCTCCACTTCGG
TGCCGACATGCTTTACTGGGAATGCGGCTGCCGCTCCGCCTCCGAGCTCAACCACCATGGCTACACGTACAAGCGCTACC
CTGAAGACTTTCGCGATCACTATGCACCCGACATGTCACCGCAGAATATCGAGACCCGCCGAGACCTGTATATAGCCGAA
CGTGAAGGTCGTGGCTTGCGATGGCATGACAAAGAGGCGGTGCGGCGACGTCCACCACCACCGATGCTACATCCAGACAG
CCCGCCAAGCAGTCAGGAAGTATGGCTGCGCAAGCGTGGTTTCTGGAAGAACGTGCTCAAATCGGATTCTGAGCCCTGGA
CGAACGATGAATCTGACGACCGCAAGAAACGACCACGAGCCGGGTTCCGGGCAGACTTTGAGCTGTTACGCCTGGGTAAT
GCGGAGAAAATAGCAACAGCAGTGGCGGAAGAGTTGGCGAAATACCATCTCAGTCTCATGGCGAAATGGTTAGGTGCAGA
GCCGGCACCGGAAGACGAGTCTCGCGAGGTCGGACAGTACAGCTACAGTCAGCTGTGGTATAACATTATCGAGCCGTACT
CTCGTTGTCTGCTAACTACTCCCACGGACAAGTTGGTGGCCATAATGGGCCTCCAGGAGGAGGTCGGACGGGCAACGGGA
TCTACGTACCTACATGGGCTATGGAGCCAGCGGCTGGCGACGGATCTGCTATGGTTTGCCATAGATGGACCTGGCCAGCG
GCTTCGCAAAGATGGGAAGAAGCCCGAAACTCCAGCCATAGATGGATCTGGCAAACAGGTGGGCAAAGAACAGAATAAGC
CCGAGGGACCACCTGTGGCACCGACTTGGTCCTGGGCGTCAATTGTGGGCGCCGTCGCACTCGATCTGATGCCGGAGAAC
TCACGTGCACACATCGAGCTGAAAGCTACTCTGCTCGCGACTATTCGCATCATTGACGGGAAGGACCACCCGAGCTCTAC
GGCGATCGAGCTCTACGGCCCCGTACTAAAAATAGAAGCAAATTGGCTGACGTTCGATGGTACTGTATGGGGTATCCACG
CTGGTAACACAAGACGGCCGTCGGCAAGGTTCTTCCCGGACGTTGCCGGGAGAGACGAACAGTCTCGACAGAGCTTAGAA
GGCGCAAAAGATCTGGTATGCCTGTCCGCTCTGGTCCTACGACGAAATAAGTCCAAATTGGCCATGACATCCTCCACGGA
AGATGTCCAGGGGCTTGTACTTCGTTCTGTAGAAGAGACTGATGGTGCAGCTGGCAATAATCACGGGGAAGACAATTCAC
CAAAGGATTACGTTCGAATCGGCTATTTCACGACAAGCTACATCGCCAAGTCTCGGGAGGCGGCTCAAGGCCTGAAGGCA
CTGAAGAGGGCCGAGGTGAAAAAGCTGTGTCTGAGAGGGTGGTCTGGGAGCAAGATTGAATACTAGCTACGGTTATGGCT
CTTGTAAACCGGCACTGTTAAGACAAAGGCCATTCGGGTGTAGTGAAGCGGTAGCTAAGGAGTATAATTATCACGGCTTC
CGTACTAAAGCTCGTGGCGTCATTAGCGTGCCGATAACATCTCTTATCTTCTTATCGATACCATATTTTTTAAACTTTTT
GAACTTTTCTTCGCGACAGTTTTTTCCCTTGCAGTGCAGCAGACCTTTCCTCCTCACTCCAAGCGGGTTTTTTACGAGCA
GCAGTCCAGCTACGAAAGCCATACTGCTGATACACAATGAAGCTCGCAAATGCCGGCACGGTCCCCGTGTATACGGTCTC
GGGGCCCTCCTCGCGAGCTCTTCCCGACTGGTTGGCGAGCAAGAAGAAGCAAAGCCTGAAACACGATCCTGAATATGCGA
ATCGCCTGGAGCTGCTGCAGGACTTTGAGTTCACGGGCGCCAGCGGCTGCATTCGCGTCTCCGAGGATGGCGAGTGGGTT
ATGTCAACCGGAACCTTTCCTGTAAGAACCAGCTTTCTCTACGCCAAATACGCTTTTCCGTTTTCTCGGGCCCGCAAGGC
TGACTGACCTTTATCTTTGAATTAGCCTCAAATACATGTCCACAACCTACACCAGCTCTCGCTTTCCTTTTCCCGCCACA
CCGTTTCTTTGAACACAAAGTTCGTTCTTTGCTCTACGGACTATTCCAAGTCGAGTACGAACTTCCTCTTCGTTTTTGCT
TCGTTGATAGTCTGCGGAAACTTACTTAATATGCGTCTCGTATAGTTCATCTCCAAGAGGATCGGAGGATAGAATTTCAC
ACACCGGCAGGATGCCATTTTCAGCTCCGAATCCCGCGGTTTGGGCGCGATATTGTCTATGAGCGACCCGCTCAACGGAG
GTCCTCGTCCCAGCTGCCGGACTGGACGCTGACGGACTCGGTGAAGTGTTCCGCCTGAACTTAGTACGCTCCAATATTCT
CATTCTGTCCCATGCATGTCTACATACTGACTTTCGGTGTGTTGTAGGAACTGGGAAGATTCCAAAAGTCATTTCAGATC
GACTTGGGCGCGGATGATGGCGTTGAGCGCGGTCTACAAGGAAGCATTGGCGTCGGGTGCGTGAATGTGGCTGCTCTGGC
AGAAGAATCGCACGGCCTGGCTGCTTTCGGCACCTCGCGCGGCACAGTCGAGTTTTGGGACTCCCGGAGCCGGGCGAGGG
TGGCCACACTAGACACACACGACGGCGAGATCTCGGCATTGGACTTCTCGCGCTCGGGCATGTCGTTGGCCACGGGAGCA
AGCTCCGGCATCGTGCAGATATACGATCTTCGGCGGCCGACGCCTCTCATGACCAAGGATCTCGGCTTTGGTTACCCCGT
GAAGAACTTGATGCACCTGACGACGGCATCGGACGAAAAGAAGATTCTGGCGTCCGATAAACGGGCAATCAAAATCTTTG
ACGAGACAGACGGCACGCCGTGGACGACAATTGAGCCAGAGGCAGACATTAACTCGGTGGCACACTGCCCGAACTCGGGC
ATGCTGCTCAGCGCCAACGAAGGAAGACAGCAACATGCGTGGTTTATTCCGATGCTTGTGAGTTCCGAGTTCATCAGTCC
GCCGGACGGCCTATGAAGCCAGTACTAACTTATTAGGGCCCTGCTCCGAAATGGTGCACATTCTTGGAACGCCTCGTTGA
CGAGATGGCAGAGGAGGTATCGACCACAACGTACGACAACTACAAGTTTCTCACGCTGGCCGAGCTCCGTTCTCTCAGCT
TGGCTCATCTCGTCGGCAAGACAAATCTGCTGCGGCCATACATGCACGGTTACTTTGTCGCGAGCAAGTTGTACGACCAG
GCACGTCTCATTGCCAACCCGTACGTGTACGAGGAAGAGCGGATGAAGCGTGTCAAGGAGCGGATTGACAAGGAGCGGTC
CAGCCGGATCCGTGGCAACAAGAAGGTCAAGGTCAACCAAAAGCTGGTCGACAAGCTTCTCAAGAAGCAGGAGAAGAGAG
ACACCATCGATCTGGAGGCTGGAGCACTGGGCGACGAACGTTTCAAGGGTCTCTTCGAGGACGAAGAGTTTGCCATCGAT
GAGAAGAGCGCAGAGTTCCGGGCACTCAACCCGAGCACTAGGATCGACGAGACCGGCAGGACAATCTGGGGCAAGCACGT
TCCCGCCAAGTCAGACGCCGATTCGGACTCGGACTCGGAAGACGCTGACGACAGCATCCGGAAGCCTGACAGCTCATCCC
GCAAGCCTGTCGGAGGCGAGGTGTCGATGCGCATGTCTTCATCAGCGCGACAGGGCGGCAGCAAGTCGAAAGACAGCACG
TTTGGAGCCCGTGTCGAGCAGATGGCAGCGTCGAGCAGCCGGAGCCACGGAAAAGGCGTGCCGGTTCGAACCCGCATCGT
GGGCGAGCGGCAGGTTACCTTTGTGCCCGAGTCGTCCAAGAAGAAGGAGGAGCCGGAAGCTGTCGAGAAGCCGGCGCCGA
GACGAGACAACAAGGCTCGACGAAGCGCCAGCGGCAACACCTTTCGGAGTCTTAAGCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62