GenePrediction:GLEAN_3020 Details

Name: GLEAN_3020
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:258583..261310 (+ strand)
Length: 2728
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:258583..258630 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_160:258704..261310 (+ strand)
Length: 2607
>GLEAN_3020 class=GenePrediction position=GCSC_160:258583..261310 (+ strand)
ATGAAGGCTGTCACCGTTCTCTCCCTCGCGGCGGGTGCTACTGCAACTGTGAGTATATGCACATATGCACATATGCACAC
GCACACACCTGATGGATCTGTACTGACGATGGGATTCACAGGGCTTCGGCAGTGGCAGCTCCTTTACCTGCCCCAGCAAC
CCCAAGGACAAGTGCTCGCCCAGCCAGTCCGGCGGCTGGACTTTTGACGAGCTTGACCTGGGTGGCTTCTCCAGCTTCAA
CGACTTTTCGTGGTCCGGCTTCAGCTGCGAGTCCCACGCGGGCAAGCGTTCGCGCGTCGATCGTCGTGGCGGCAGCCGCT
ATGCCGGTGGTTCTTGCAGCTCCGAGATCTCTTCCTGCCCGTCGTTTGGCAGCACCGGCCAGTCCGAGTCCAGCAGCTTC
TCCGTGAGCGAGATCCACATGTCGACTGAGTTCGACTGCGACCTCGACTTCCACTACGGCATGACCGATGGCTCTACCTG
CAAGCAGCGCAGCAGCTGCTCCAGCGGCGGCTCCGTCATCACCAACAGCCAGTGCGGTGGTGCCACGGCCGTCACCGTCG
TCTACCCGTCGCAGACCGGCAAGCCCAAGCCCACCTGCAGCATCAGCGTGTCCACCATCTCTTTTGCCTGCAGCTCCACC
ACCACGCCGTCCACCAAGGCCACCACTTTCCCCAACGTTGGCCATAGCACTTCCAAGGGCCACAGCACCAAGGAGCACAG
CACTTCCATCAAGACCACGCCGGCTCTTTCGGTCCCGACCATCTCCCAGGGCTTTTCTACCGGCTTCTCTACCTCTGGCT
TCCCTGGCTTCTCTACGTCGGTTGTTTCGGTCCCGACCGTTTCTTCCCCGGCTGTGTCGGTCCCGACCTTCCCCTCGAGC
GTCTCTATCCCGGGTTTGTCTTCTTCGGTTTCGGTCTCGGTCCCGGCTGTCTCTTCGCCTGCTGTTTCTTCTCCGGTCGT
CTCAACGCCTGCTGGCCCCACTTCCGCTGTCTCTTCCCCGGTGATTTCGTCGCCTGCTAGCTTCTCCTCGATCGTCTCGG
TCCCTGCTGGCTTCACCAACACCTCGGTCGTGTCTACGCCTGCCGTGTCCTCGCCTGCTGTGGGCACGCCCAGCAGCGTC
GTGGTCGTGTCTTCGGTCCAGTCTTACACCACGTCGACCATTTTCACGACGTCGACGTCGACGATCATCAGCTGCGCCTC
GACCGTTACCAACTGCCCGGCTGAGTCCTACAAGACTACCGTGGTGACCGTTGCTGTGTCGACGACTGTCTGCCCCGTTA
CTGCTACCGAGACTGGTGTTGTGTCTACTTCAGCCACCGAGGCGGTCTCTTCGCCGGCTGTTTCTTCTCCGGCTGTTGCT
TCGTCGACTGGTGTCGTTTCGTCGCCTGCTGTCTCTTCTCCGGCCGTTGCTTCGTCGACTGGTGCTATCTCGTCGCCGGC
CGTGTCTTCCCCGGCCGTTGCATCGTCGACTGGTGCCGTTTCGTCGCCTGCTGTTTCTTCCCCGGCCGTTGCTTCGTCTA
CTGGTGCCATCTCTTCGCCTGCTGTTTCTTCCCCGGCCGTTGCTTCGTCGACTGGTGCCGTTTCGTCGCCTGCTGTCTCT
TCCCCGGCTATTGCTTCGTCGACTGGTGCCGTTTCGTCGCCTGCTGTTTCTTCCCCGGCCGTTGCATCGTCGACTGGTGC
CGTCTCGTCCCCTGCCGGCTCTTCCCCTGCTGTGGGCACGTCTAGCACCGCTGCGGTTGTGTCTTCGGTTCAGTCATACA
CCACCTCGACCATCTTCACCACCTCGACGTCCACGATCACCAGCTGCGCCCCGACTGTCACGAACTGCCCGGCCGAGTCC
TACAAGACGACCGTGGTCACTGTTGCCGTTTCGACGACCGTCTGCCCCGTTACTGCCACTGAGACCGGTGCCGTGTCTGC
CTCTGGCTCTGCCACCACGGCCCCGGCTGTTGTCGGCTCCACGACGAAGACTGCTGCTGTTGCCACATCGACTGTGTCTG
TGCCGTCTGTTGTGCCCCAGTGCCTGAACACATGGATGTTCTCGACCGGCTGCTCTGACAACACCGATGCTGCCTGCTAC
TGCCCTGACGAGGTCTTCGTGAAGAACATCTTCTCTTGCGTGTCTGCTCACGGTACGACTGACGATGTCATCTCCGAGGC
TGTTGTCTTCTTCCAGGGTGTGTGCGCCGGCTACGCTGGCGGAAACCCTGCCATTGTTACGGGTGCCGCGTCTGTGACAA
GCACTCTGACTGCCACTGCCACCGCCTATGTGACTGGTGCCACGTACACGACCGTGTTCGCGACTGCTACGACCGTTGTG
CCGTGCACCGATGCTTCGGGCTCGACGATCCCCGGCTCCAGCACGACGGCTGTGGTCAGCACTGCGGCCACGGTGCCCCA
GGTTGGCTTCGCCACGGGCGCGACTGGCTCTGTGGCCGTTGTCCCGGTCACCAGCGTTGCTACCTCGGTAGCGACCAACG
CTATCGTCGGCACAGCCCCAGTTGCGGCGACTGCTGCCACTGGTGCGACCTACGCCACGACGACTGCCGTGGTCCCGGGT
GCGGCTAAGGGCACTGGTGCGGCGTCGGCCTCGGGCGCTGTCACTGGCACTGGTGCCTACATTGTCCCCAAGCCGTCCAG
CTCGATTGTGGCGGTTAGCAGTGCTGGCCGCACCCAGGTCTTCGGCCTGGCCGGTGCTGCCGTGATGGCAGTCCTGGCTC
TCCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62