GenePrediction:GLEAN_3021 Details

Name: GLEAN_3021
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:262110..263579 (+ strand)
Length: 1470
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:262110..262991 (+ strand)
Length: 882
Type: CDS
Source: GLEAN
Position: GCSC_160:263058..263579 (+ strand)
Length: 522
>GLEAN_3021 class=GenePrediction position=GCSC_160:262110..263579 (+ strand)
ATGGAGACTGAGGCGACCGAGACGACGACGACCGCAGCCGCGACGGCTCTGAGCGTAGCAGAAGGACGGCGAAGGCGGGA
GCGGAAGCCGACGGCGACGGCGACGCGGTGGCCCGACTTTGAAGCGCGGACGACGTACGAGCCATCGACAGGCGTGCCGC
GGTCATATTTCCTAGGCCACCACCGGGCAGCGCTGGACCACATGCGGCGGGTATTGGCGACCGTTGGGCTGGTGATTGAG
TGTCGGGATCTGCGGGTGCCGCTGACGGCGTGGAACCCGCTGCTGGAGACGTCGCTGTCGTCGGGCGTGGCGACGGAGGA
GGAGAGAAGCAGCAGCAGTGGTCGAGGGGATGAGGGCCAAAGCAAGACGGGCGGCGTGGCCGGCCTGGCGAGTCTTTCCT
CGGCCGGTCCCCTGGCCTCGTTTCTGCCGTCGGCCCAGACTGACCGCATGCGGATCATCGTGTACACGAAGCGGGATCTG
GTCGTGGATGAGTCAGCGGGCGGAAGAAGGTCGCAACGATCCCAGGCCGCGGCCTCGCTGTCGCCCTCGTCAGCCGACCT
TCGTCGGCTGGCCGGCTTCCACCGAAACGAGGCCGACGCGGTTCTCTTCATGGGCGGCGGCGACGAGCAGGGCACGGCAG
CCGCTGGCGCCGTCGCCCGACGCGAGGCCTCGCGGCTCGTGGCGGCCGTCCGGGCAGCCGCCCAGCGCCACGGCCAGCAG
TCGTTGACGGGTCTGCGCGCGCTGGTCGTCGGCATGCCCAACGCTGGCAAGTCGACGCTGCTGAACCGGCTGCGCGCTCA
TGGCATGGCGGATCCGTCGCGACGGGCCCGGGCTGCCAAGACCGGCTCGCAGCCGGGCGTCACCCGGAAGCTGGGCACGC
CCGTGAGAGTCTTGGGGGGGCCATCTTTGAATTCTTCGAATTCTCCGAATTCTCCGAATTCCTTCAAGACCCCGACTTCC
TCCGACGATACCCTCCTCCTCATGGACACCCCCGGCGTCTTTGTCCCCTACGTCCAGGACCCCGAGAGCATGCTGAAGCT
CGCCCTCGCCGGCTGCGTCCGCGAAGGCCTCGTCCCGTCCGTCGCCCTGGCCGACTACCTGCTCTTTCAGCTGAACCGCC
GCGATCCTGCTCGCTACGTCGACGCCTTCGGCCTCCGGCAACCCACCACCGACGTTCACGTCCTGCTCGACGCTGTCGCT
CGTCGCACCGGAAAACTGGCCCGCCACGGCGAGCCCGCCCTCGATGCCGCCGCCCTTCACCTCGTCCACGCCTGGCGTCG
CGGCCGTCTTGGCCGCTTCTGCCTCGACGACCTCGACCCTGACTCTCTCGCTGCCGCCCGCGATGCTGCCCGCCGCGGCT
CTCCACTCTCCCTCAATCAGGCTCGTCGCCGCGAGAAGGAGCGCCGCAAGGCTCGCCAGGCTGCCCGCCATAGCGGCATC
GTCTTCACCGAGACTGGTTCAACGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62