GenePrediction:GLEAN_3022 Details

Name: GLEAN_3022
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:268188..270380 (+ strand)
Length: 2193
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:268188..268191 (+ strand)
Length: 4
Type: CDS
Source: GLEAN
Position: GCSC_160:268624..269364 (+ strand)
Length: 741
Type: CDS
Source: GLEAN
Position: GCSC_160:269452..270380 (+ strand)
Length: 929
>GLEAN_3022 class=GenePrediction position=GCSC_160:268188..270380 (+ strand)
ATGGGTATGCATGACATAGTCCCCTCCACCTACAAGCGCTTCTGCACTTTTTTTGGCTTTCTATTCCATCCACTTCACCC
CCCCCCCTCTCTCGTTATACTGTTCCTCCGTTGTGGCCAACACCGACATTGTGCGACCTTGAATTCTACACAGCCCTCTC
AATAATTTCCTGTTTCTGCTTCCGCACAATTTTTGCCCACTCAGAAAGATGAGAACCGAGCAGGCGGCTTTCACCTCCCC
CCTCCCCCATAGATGGATATCTCTATTTCGGCCCAGCGTCTGCAACAGTGGCACACTTGGACCTTGCTCCCTTCACCCCT
TCTCACCCTGTTTGTCCTTTGCAGCTGCGTTTGGGTCCTCTGGCTAATTCGCCGCAACGACCTTTCCCTTCTTCCAGGAC
TCGCTCATACTATGTCGCCTGAAACCGTTTCGTCAGTCTTCCCCGACCGACTGATTTACCCGCTACCCAAGCGTCGCCTT
CGGGAACGCCTGTCTCCCAATGTTGCCGACTCTATTCAGTTTCCGCCGGCTCACGTTTCGGGGTCTCCGTTCTTCTACTA
CCCATACAGCTTGAAGGACGACGTGCCTGCGGCCTTGGAGAGGGCAAACGTGCTCAATCATCGCAGAACGGCCACCACAC
CTCCCGGCACTGCTCTATACCCAGATGCATCAAACTCCCTTCAAGTACGCCGAGACAGTGACGGAGATGGGCCGCTGAAC
TCCTCCCGCGTTGTTCGACTCGTGAACCGCATATCGCGGCACCAACCCACCCTCATACCCTCCCCACCGGACAGCCAACA
GGCGGCGCCGTCGGCTGCGTCATCCGTCGACGGCTACGACTCGTTCGAGAACACCAACAACAAGAAGAAGAGAAAGATTC
CCACTGCTGGCGATGCTTCGCATGCTGGGAGTTACACGTCAACCGATATCCACTCGGTGTCGTCAGGGCCTTTATCTACA
ACCACAAACGATGATACCTTGAGTGGGGGCTCTCTGTCCAGTGCCTATTCGGGCTCCGCCAGTTTCGTAGCAGCAGCTCC
CGGTATATCTGGGCCGGGGAGGGGACGCTATGGCCGGAACCGGAACGGAAGAAAACCCCTCCGACCGTTGCCAGAGGCTG
GGAGCAATTGGTCGGGCAGAAATGGGAAATCACAGCCCCCATGGCCAACACCGTTGGGTAGGTCTGCTTCTGGTGCATGC
TCTGCATTTGTGACCCAAAACAACGCGTCTCAAAGGCATCTATGCTAACAGCTAATCAATACAGAAGCCGACCGAATGCC
GACCCATAGCACAAGCACAGGCATTATATCGAATGCCATTGCCAACGCAGAAAAACAAGCGTCACGTGAACAAGAGAATA
CCACTCATGTTCGGGAACAGCCTTCGGTGATGTCGAGTCCGGCATCGGCTCAATTCACCTTTACATGCACGTCACAAGTA
CCTGGCAACCTCATGTGGCCTGGATCCGACCCTAAGATCCCAACCGGATCATCACAGTGGCAACAGGGAAGACTTCGTGG
CGGCCATGGGCAGCCGGGGAGTGAAGGCGGCCGCGACAAAAGCTTGGATAGGTCCGACGAACCGGACGCGGCGGGCAGGT
CTCTGAGAGGATCGGATGGCAGCGAAGCGAAGCTATCGGAAAAGGCCGCCTTGAAGAAGCTCGACAGAGAGCTTGCTAAG
CAGGCCAGGGAGCGGAAGCGCATCCAGCAGCGGCAGAACGCGGTCACTTCGCCGTCAAGCGAGTTCTACATTTGCCCGTT
TTGCGAATATGAGAGCTTTTACAAGAAGAAGCCAAAGAGCTTTATCCGCTCGTTTGAGCTGAGGGAACGAAAAAAGCGAG
AGCAGGCTGAAGAGAGGCAGCGGTTGCTGGACAAGGCCAAGGCCCGCGGCCGCAAGGGCAAGAAAGCTGCAAGGGCAGCG
ACATCTTCCAAAACGGGGAGTTCGACAGACAGCCAGGCGCAGGGGGGCCGAGTCAGCGACGAGCTGCCAGACGACGTCCC
CAATGGCGAAGGCTTCTATGAAATCGATGACGATGGCGGCGAAGAAGATGTATACGGTGGCGTCCTCGACAGCTTATTGC
CAGTGCTAGATGGGGGTGGCACGACGAATTCGAAAAAACTATCTGGAGGATGCACGCTCCGGCTGCAGGCTATACATATA
CCGGACCATTACTGCAAACCATTCGTCAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62