GenePrediction:GLEAN_3023 Details

Name: GLEAN_3023
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:271645..276296 (+ strand)
Length: 4652
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:271645..271680 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_160:271959..276296 (+ strand)
Length: 4338
>GLEAN_3023 class=GenePrediction position=GCSC_160:271645..276296 (+ strand)
ATGTTTGGCTCCCGCAGAAAACGCCGGCCGTACACGGTATGTGAGCAGAAAGAAAGAAGCGTGAGACACGACGGACAGGC
GCTACTCTCATCGAGGGGGGGAAAATAGCGAGCCCTGCGCCACCAACGCCGGCAATGGCCCGGGTTCTGGGCAGCTGTCT
ATCCCTTGGCTTTTTTTGCGAGTTTTGCAGGCGATTCGGCCGTTGTCGTCATCGTCGCCCCGATCTTCACACATCCTCTT
CTCGGGCTTCCTGCCAGCAACAACATCGATGCATCGTTTCTGAGGACCCTCAACGGACGGCTAACATGGCACAGTCTGCT
ACATCTGCGACAGTCGATCCGAATGCGGCCACGGCTGCTGCTTCTGCCTTCCATCTCTCGTCGGCCGCCGCCGCCGCCGC
CATCCGCGCAATTCCGCTTTCACCGACCAATGTTGCCGAGGTGCAGACGGCACGCACGTTGCGACGTAGTGCGTCGGTCT
CCTCGCAGGGCTCGCGTCGTGCCTTCAGTCCGGTGTCGACCCTGCGACGTGCCAAGGGCAATGCTGGAGGAGCGCCGACG
CTGCGGCGCAAAGGAAGCGCGTCGTCGATGAGCGAGCGGTCTTTCCGTTCGGGCAGTCCACACCATGCGCGAAGAGCGGC
TGCTGCCATTGCCGCCGCCTCAGCCTCTTCGCTGCCTGCAGGTCACGACAGGACTCAGAGCGTGGCTGCCAGTGCGGCTG
TCGCAGCCACACACGCGCAGTCGCATTCACGGTCTCTCGACAGCAGAAGCCGATCGGTGCCTCCACTCCCAACTGTCCCA
ACTGTACCGAAACAGAGGACACAGCAGCCAAAGACGGCTCGAGGCTCGTGGTTTGGCGGTGCCGTCGTGGGTGATTATGC
ACCTGTGCAGACATCGGCCCAGGACGGTCGCCCAAGCAGTCGCAGCTCGTCGATCAACTTTTCGTATCCCAGCCGCGCCC
GAGTTAGCTCGCCACTGCCGACCAACGCCAACGCTTCGCAGACCGAACCTGTCGCTGTCGTCGTCTCGGTGCCTGTCGCA
AGACCGCCAATGCGGGCAGCCTCGACTGAGCGGACGCCCAAGAGCTCGCTCGGCCGTATGATGAGCCACCGGAGATCAGC
ATCGACGAGCCGGGCCACAACGGCATCGAGCCGGACAGACCAGTCACTGGTGTACGACCCAAACTCGCGACGAATGGTGC
CACGGGCTGAGCTCTTGTTCATGGAACAGGAGGTTCTGGAGATCGAAGAGCAGACGAGACCGCGCAAGAAGAAGGCCGCG
CCATCACACACCGGCGTGCATACGACCAAGGCCGCCACAACACGGACACATGATTCTCCACCACAGCATCTACTGCGCGT
TCCAGCTTTGTCGCCGCCTGCTGTCCAGACACGCCCTACTGAGCCGATGACCGAGGTCCCAGCCGAGAGGGAGTTGGACG
AGTTTTTGCAGCCACCCCCAGCCCTGTCAACATCCATATCTACGCCATCCTCGTCGGTGTCTTCGCTTGCAATTCCCCAG
ACAGCAGCAGCCGTGCCGATGGGAGTTCAGACCGAAAACAAGGAGGACAGCCGCATCGAATCTTCGCAGACAGAAGAAGT
AGCACGACCACTCTTGCTGAAGCGGCCGTCCCGTGTGAAAGAGGAGCCGGAGCGCGAGAAGGAGGAAGAGGAAAGGCGCC
ATGAGCAGCATGGGCAACCTACGACGGTCGATGTGCGTGAAGGAGAGCAGCCGAACAACGCTGGACGCACCGCCCATTTC
GCGCCTGTCTCGGGCGGACTCACCGTGCAGCGATACTCACCGCCACCACGGTCGATCTCGCCGCGGAAATCTGCCATGAA
GCACGCGAACTCGCCGAGAGATCCGTCTCCGGCGGACGGGTCCAAGGAGCCTGCAGCTGCGTGTCCGCCGCAGAAAGAGC
ACACGCTGGCGAAGAAGTCGAACCGGGTCAGCTTCACGGACGAGAACACAATTCTAGTGCACCGGGACGAGGAGGAGGAA
GAGGAGGAGTCGGTGTCACTGCCATCTGCACTGCCGGTAGCAACAGAAACGCCGGCCAGCACATCCGTTCCGCCGGCACA
CCGCCGATGGTTCAACAGTCTTGGTCGGGGCAGGAAGAACGACGCGGCCGCAGGTTTGGAAGATGACCAGATCATGAAGC
CACGTCCGGCCTTGCCGTCTTTTGGTAGCATCCGAGAGCGAGCACCTGTGCAGACGAAGCAGCCGGAAGAGCGGGCACTG
ATGCGGCCCCATCCCGCATCATCGCCGGCAGCCTCTGAGATATTGCAGGAGCAGGCAACCAGTCCCCGGAATACGGCTAA
CACGTCACGCTACCGGGAGCCCCTACCGCCTGTCGTGACGTCTGTCGACGGCTGCGGATACAACTCGGACAGTGACACAA
GCACGGTCAGCAACGAAGACATAGTGGATGAAGATGAGGACGAGGACGAGGACGAGGACGACATCACTCCCATCGCAACG
CCAGCTGTTCACTCATCCATTGCAAGCAAACGAAACGCCCCTCTGCTTCCGGATATATCGGTCACCCGCGCAAGTCAAGA
GAGCCTTGAAGCGACCAAGCCAGAGGTTGAGGCTGATGTGGCTACCGAAGCAACCAAGCCTAGTCCTACCGGCTCTTTCT
TTGATGTGCCCGGCATGTTCCCGGACTCGGAATCGGACAGCACGTCGCGGAGCGGATCGTCGCCGACAAAAGCAGGGTTT
GTCATGGCTGAATCTTGTGCGGAAGACGGAGACGACCCGCTGGCGATGCAGTCAGCCGGGACGGTTCTCGCCGCTCCGAT
GCCGACGGTGCCAGAGGAGCCCGGACCGAACGAAGCGGACGAAGACGACACGGACACCAGCGTCTATAGCGATGCCTACG
AGGATCTGTCGGACATGGAGGGCGACGGGTTCCTGTCTCTCAATGCTGTTGTGGAGAGCCCGATCCGGGCGGCGTTATCA
CCGCTGCAGCCCAAGTCCGAGAAGCCTGCGGAGCAGCAGAAGCAGTCGCCACCGCCCCCATTTTCAGCAGGCCTGGTGGC
CCGCGCAGCGCAGGTGGCCGAAGCAGACATCGGAGGGCTGCCGTCTCCGGCGGACAAGCCGGCCCAGCCGGCCAAGCAGG
AGGCCGATCAGGGGTGTGAAGAGGACGACTGGGAAAAAGTCAAGGCATTTTGGCGCAGCCTCTCGGAAGAGAAGCGTGCG
CAACTGGAGTTGGCCGCCAGGGACGAGGCCGGGGCCGATGGCGACCTTGAGGAGGCGACGCTGGAGAAACGGCCAAGACA
GAAGAAGGCAGCCGAGACGCGGGCGGCCGAGAAGCAGGGCTGGGCGGACGGTGAGGTGCGGCCATCGAAAGCAGTACTCC
CGCGGATCCGACGATCTATGCGCGAGGCCAACAGACAGGAGTCGGTACAGGCGCAGCCTCGACAGACAGGACAGAAGAAC
GGGTCAGTCGGCAGTGCAGCCAGTACTGTAAGCCTGCGACGCCGAGGTTCAGATTCCAGCGAGAGCAGCTTCAAGCGGTC
ACGAGGCGACGACGGTGGCAGTGGAGGCGGTGGAGGTGGTGGTTTTCGCAAGACGATGCGGCGAGACTCCAACGCGTCGT
CAGAACAAAACCGCAGCAGCCGCTTTTCGCTGCGGTCGCTGTCGCCAGCAGGATCAACGCTGCGTGGCTCGCACACACAG
AGCTCGGAACCGCCACAGCTTCGCAAGTCGCTTCGGGACAGCAAGACAAACAAGCCAGTTGGTGGAGGCGGCGTCTTCTC
GTCGGTCAGCCGGTCCAATGGCAGTAAGCTGCTGCTACAGCGCGGCAAGAACGGGCCGTCGAGTCGCTTTGGCGATTCCA
GCGACGAGGATGACGACACGCTGGTTGGCAGTAATGCGACAGGCAGGAAAGTGAGCAACGGTGGTGGTGGTGGTGGTGCA
GCGGTTCGCAGCCGGTTTGCCGATTCGAGTGACGACGAAGACGACGACGACGATGCCTTCAAAGGCCTGGCAGCAACCAA
ATTTAATTCGAGAAACTCGAGCCACCGAATGGCCATGTCTCTGCGGCCAGGCAGCGCAGGTGGTCGTGGCAGAAGGTCCC
TGAGCCCTCCGCTGCCAGAAGAACTGGAGGAGGAAGAAGCGGCGGCAATGGCCGGTGGAAGGCGGCCGGGACCAGAAAGC
CGTCGGGGTGTTGCCTCGTCGGCCACATCGACGCTTCGGCGGTCTCGTTCCGGCCGTGGCGAGATGGGGGTGTCGTTGAC
CGGGATGGCAAATAGCCCAGATCAACAGCAGCAGCTGCGGCATCGACGGTTGAGCAGCACGAGCAGTTTCATGTCGGCGT
TACGGCGCAAGAAGAACGGTGGCGTCGGCTACACCAGCAACGGCCGGATGACAGAAAGTGCGGCTCGACGCGACACGGAG
CTGGAGCGAAGTGCTCGAGAGCTGCAGGCGGTACGGAACAGCAGCGATCGCGATGAGGACAGCAGTGGGAACTATGTCCT
CAGCGGCAGCAACGTCGACAACAACAGAAGCTGGCCCCTGCGAGGAGTGCATGCGGGAGCCGGGACTTACCAGGCGTCCG
TCTCGGCCGGCGCTGCCTTGGATGGCTCGCTGCCGGAACGGAGGAAGAAGATGTTCCCGGCGCTGCGCAGAATGTTCCGA
CTGGATGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62