GenePrediction:GLEAN_3024 Details

Name: GLEAN_3024
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:282280..284652 (+ strand)
Length: 2373
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:282280..282520 (+ strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_160:282893..284652 (+ strand)
Length: 1760
>GLEAN_3024 class=GenePrediction position=GCSC_160:282280..284652 (+ strand)
ATGGCCTCTCCACGCACGCAAGACAGCGGTTCTGCTACTGCCTCGTGCCAACCCGGTCCAGCAGAGGACAACAAAATGGC
AGGCCCAGAATTGAGCAACCAAGTTGGAGATGACACCACTATCGAAAATGGGGTTCCCCAGATTCTGCCCAAGGGCATCG
TCGCGAACACATCGGAAATTTATGCCGAGGTCGCAAGCTATAAAATCGTCCCTCTAGAACGGCTCAGGGAGTACTGGCGC
GGTTCGTTATAATTTACACCTCTGCCTCTTTTGGCTATCCTAACTTGTCGGACGGTTGGCTAATTGATGCCGATTTAGTA
TATACTACAACGCATCGCAGGTTGTATGACCCGACCGCTAGCCGTCTGGAGAGTTTTTGGTGGCATGTCTGGGGCAGCGA
TCGCCGCTTTCTCAGTGGAAAAACGCTCGCAAAGCTGTATGAGAACATCTCGAATGGTCCTACGTTTGTTCCTCTGCGTG
GTCCTTCAAATCGGTACGAAGGCCCGATGGTGAGCGCCCTTGAATGGTTATCTCTTGTTTTGCGTGTTTTTCGCTTTGTG
TGTTGACACGATTTTCACGAAGGCTCCTCCTTTCTTGCTGCCAAGAATGACAGCACAGTTCATGATGGAGCAGCAAGGAA
TACCAGAGAGGGAACAGGAGAGACCGCAAACAAGCGAGACTGGCCAGGACAAAAGGCGTGCAGAAAGTCCAGGCCAAGAC
AAGCCGGACACCGCCACATCCGAATCAATTTCGAAGCCTTCCAAGCAGGCGGAAACAGCAGAAACAGCAGAAAAATCCGT
CAAACAGCAGGAAATCGGTAATACGAAGACCAGACATGGAGAAAAAGATGACGTTGTTCAGCCGAAGAAGATTTCGTCAT
CATCCACAAGGCCGCCACCTTCGCAGTCAATTCTCAAGAAGCCGAGGCCTTCCCTTGCTGGTCCACGCCCGACACCTCGC
TTTGCATTGCCATCTGGCGAGCCGGCTGACGACAAGCCGAAGGAAGGAGCGGCTACAGGTGACAATGCCGTTGAAGGTAA
TAACGTCTTAAAGGCCGGCGCAAGCGCAGCTGTTGGCAGCACTAGCAGTGAACAGAGCACACCCAAACCCAAAGAACAGT
CTTCGGTTATTACTCCCAGCAGCAAATCCGGAACGGCCAAACAAGATGGACGCAAAGCAAAGCCAAAGCACGCCAAAAAA
AAGTTTGTGGCAGGCATGGCCTCGTCCAAGCGGAAGGCTGTCGTTGCAAAGCGCTCCAATTCTCACTCTTCCACGGGCTC
CGCTGCTACTGAGGCGCGTGAATTAGTGTCGTCTCGCCAGTCGGAGCAAACAGCTGTTGAAGAAGAGGGAGTCGGTGAGA
TGGATGAGATGGACGAGATTGGAGAAATTGAGGGCATCGTATCGTCATCATTGGGATTGTCTGATCGGGGCGCGGACGTC
TCGCCTAGAGCGCATGCTTCTGCATCAAACCTGGAGAGACAAGCTGCACGGCCGAAGGGCACAGAGACTGCTGGAAAGCA
GCCAACACAGCCGCCTCCGTTGCCGCCGGTGCGTCCGCAGCTGTATACGTCGTCACCGACATTGATGTCACCGACAGCTT
CGGTAGGATCAGTGACGGGTTTGGCAACTGCAGCTGCTGCCAGAGGTCCACAGCCCGTTGTAGTCCATCAAGGACCTGGA
CTGTCTGCAGCGTCGGGACAAGCTGCAACGTCAGCCAGTCTGGAGTCGACTGGTGGATCGGGCATTCTGGAAATTTCCAT
GGCGTCTCGAAATCGACGCCCGGTGAGCCAAGTTCTGGGCGGACCAGGTGGCACGCCGAGCCGCCAGTATACCATGCCGG
AGGTGTCGAGCCAGCGGAAACGACTGGCAACTGGACAGGGATTCGGAGTGACGGGCGCGCCAGCGCCAATATCACCGGGC
GCGATCCCCCCTCGCCTCAGCCGGTCGCTCTCACAGGACAGCTACGCGCGGCATCATGTCGGCGACGGGGCCCAGCGGCC
AGCATTGCCACACGGGATAGGATCGGCTGCGATCGCGGCGCCGTCGATGGTGGCAGCCAGCGGGGTACTGATCGAGACAG
AAGGGCCAGACCCGTTTGAGCTGTATGCGCAGACGGGACTGGATGACGACGAAGAAGCAGAACGGCCGCTGGTGGAGAGC
TCGTCCTACAACGAGCACAGTCCGGTGCAGCGGCAGCTCTTCACGCCGACACGGCCGTCACAGACGCCTCGCATCCCCTT
TGCTCGAACGCGTAGTCAGCTCAACATCATACTGGATCGCGAGAAGGAGCGTCTTGGGCAGGGGAATTTTGCATCGTGGC
AGGAGTCTCGGCACCGAGACCACGAGGGGGATGATCAACGATCTGGACGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62