GenePrediction:GLEAN_3025 Details

Name: GLEAN_3025
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:286959..290120 (+ strand)
Length: 3162
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:286959..288187 (+ strand)
Length: 1229
Type: CDS
Source: GLEAN
Position: GCSC_160:288260..288334 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_160:288534..288620 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_160:288945..289966 (+ strand)
Length: 1022
Type: CDS
Source: GLEAN
Position: GCSC_160:290029..290120 (+ strand)
Length: 92
>GLEAN_3025 class=GenePrediction position=GCSC_160:286959..290120 (+ strand)
ATGGCCACAGCTAGAGTGCTCCGGCCATTTCAGCCGCTCCGACCACTCTTCCATTCTCTCCATCATCCCCTCCACCCCTT
GTTCATATCTGCCCGCACTCCTCCACACCACCGCACTCTCGCGTCCAAGCACCCCAAAGGTTTTGTGCCACCTCCACAGG
CTGACCTGGACGAGCTCCGCGAGCGGGTGCAGGAATTTACACGCCGCGAGCTGACCGAGGAGGTGGCGGCGGCCACGGAC
AAGACCAACAGCTTCCCGGCCGACATGTGGCAGAAGCTGGGCTCAGCCGGCTTCCTGGGCATCACGGCAGACGAGGACGT
CGGCGGGTTGGGCCTTGGCTATCAGGCCCACTGTGTCGTGATGGAGGAGCTATCGCGAGCGAGCGGGTCGGTAGCGCTCA
GCTACGCTGCCCACTCGCAGCTGTGCGTGAACCAGCTGCAGCTGCACGGCACGGCAGCCCAGAAGGCGGCTCACATGCCG
GGGCTGATTGCCGGCACCACGATCGGGGCCCTGGCTATGTCGGAGACGGGAGCCGGCAGCGACGTGGTGAGCATGCGGAC
GACGGCGCGCGAGGCTGTCCAGCACGGCCGCAACGGCTATGTGCTCCGGGGCAGCAAGATGTGGATCACCAACGGGCCGG
ACGCTGGCCTGATCGTGGTGTATGCCAAGACGCGACCGGATGCCGGCTCCAAGGGCATCACGGCCTTTCTGGTCGACACA
GCTGCCCGGCCGCCTGGTTTTGCCTGTGCCCGCAAGCTCGACAAGATGGGCATGCGTGGTAGCAACACGGGCGAGCTCGT
GTTCGACGACGTCTTCGTGCCGTGCTCGCACGTCCTCGGCACCGTCGACGGAGGGGCGCGCGTGCTCATGGCCGGTCTCG
ATCTCGAACGGCTCGTCCTCAGCGCCGGTCCGCTCGGACTCATGCAGGCTGCCCTCGACCTCGCGCTGCCGTACACCCAC
CAGCGCCACCAGTTCGGCGTCCCGGTTGCGTCCTTCCAGCTCGTCCAGGGCCGTCTCGCCGACATGCATACCAAACTGCA
GGCCTCGCGCGCCTACACTTACGCCACTGCCCGCCGTGTCGACGACAGCAGCGACATCCGCACCGAGGACTGCGCCGGCA
CCATCCTCTACGCCGCCGAGCGCGCCACCGAGGTCGCCCTCGACTGCATCCAACTGCTCGGTGGCATGGGCTACATGGAG
GAGATGCCGGCAAGTCGGATTCTGAGAGAGTGCGTCTGGTCCACTGGCCTTTTTCCTCTTTTCCCCTCCTCATTTTCTCC
TCTTCTCTCCTGACATTCTAGTGCAAAACTCTACGAGATCGGTGCCGGCACCAGCGAAATCCGTCGCATGGTCATCGGCC
GAGCCTTCAACAAGCAGTACGCCCACTGAGCAGTAGACCTAGAGAACAAGTGTCAGAGCCAAATAGAACAAATCCGGACG
ACCGGAAACTTGTACATCGGGCGAGACAGCTCTGAACACGTGATGCAATCTGCACCCCAAGCCGGAGCTTTGACCCAGCC
AGCGCACACACAATTTGTGGGCCCGCAGGTCCAAGCCGATGTGACAGATCGTCAGGCCACCGCGGAACCACACCACTACG
ACGTATGCGGAGGAAATGGAGTCCGGCCGTCTACACCGATCGACTCATGCGGCCACCGGTGGGTCAGTTCTCTCCGGATG
GCGGGCCTTCCTTAGATAGTACAAAAGACGGGGTCTCGGACAGCTTGTTCAAAGTCTACCTACCAAAAAGAGGCAAGTGT
CAAGTGCCTGTCCAACTCGCACATCTTGACCTGTCAGCACCAAACCCCGACTTTCCGCCATGAATGCCCTTAAAGTTGGA
GGGGTGTCCCCTGGGACCATGTCCAGGTGTCTTGCTCACCGTGCCTTTGTCCCTACGCTGGTTCTCTCTGCAAGCACAAG
AGCTCTTTCTCGTCCAGGTGCTGCTGCTTCCATTTCTGCTTCTGCTTCTGCTCCCAACAAGACCAGACTGCCGGTCTTCT
TCTCAACCTCGACCCGCATGGCTGCTGCCGGCACGATGAAGGCGTTTATCTACGAGAGTGCCAACAAGGCGCGACTGCTG
GACCACCCGCGGCCGCAGCTGCTGGAGCCTACGGACGCGGTGGTGCGAGTGCAGAAGACGACCATCTGCGGCACGGACCT
GCACATCTGCAAGGGCGACGTGGCGACGTGCTCGCCGGGGCGGGTGCTGGGCCACGAGGGTGTGGGCGTGGTCGAGGAGG
TGGGCTCATCGGTCAAGGGCGTGTCGGTGGGCGACCGGGTGCTGATCTCGTGCGTGTCGTCGTGCTCGTCGTGCCACTAC
TGCCGTCGCGGCATGTACTCGCACTGCGAGACTGGCGGCTGGATTCTGGGCAACTCCATTGACGGCACGATGGCCGAGCA
CGTGCGCGTGCCTCACGCACAGTCGAGCCTGTACGTGCTGCCAGCGGACACGACGGACGACGACGCGGGCGCGCTGGTGA
TGCTGAGCGACATCTTCCCGACGGGCCACGAGTGCGGCGTGCAGAATGCGCGCGTGCAGCCGGGCTCGACCGTGGTTGTG
GTGGGTGCCGGTCCGGTCGGCCTAGCCGCTCTGATCACGGCCCAGCTGTACTCGCCGGCGGTGCTGATCGCGATCGACAT
GGACGAGAATCGGCTGCGGGTTGCGCGCGAGATGGGCGCCCACCACACGATCAACAACGGCGGCGGTGCCGAGGGTGCGG
CCAGGGCCGTCGAACAGGTCCGCGCCCTCACCGGCGGCATCGGCTGCGACTCCGTCCTCGAGGCCGTCGGCCTGCCGGCC
AGCTTCGAGCTCTGCCAGCAGCTGCTCGCGCCCGGCGGCGTGCTCGCCAACGTCGGCGTCCACGGCACCGGCGTCACCCT
GCACTTGGAGAAGCTGTGGGATCACAATATCAGCGTGACGACACGGCTCGTCGACACCGCCACCCTGCCGATGCTGCTGA
AGCTGGTGCAGGCACGGCGCCTCAACCCGGCACAGCTGATCACGCACAGTAAGTCTGGACGGCACGAGGCGAGAGCGGAC
AGAAAAGACAGAATGAAAACTGACCAGCAGAATTCAAATTCTCCGAGATGGAAAAGGCCTACGATACCTTCCGCAATGCC
TCGAAGCACAGCGCCCTCAAGGTGCTGGTCGAGATGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62