GenePrediction:GLEAN_3028 Details

Name: GLEAN_3028
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:298838..299246 (+ strand)
Length: 409
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:298838..299139 (+ strand)
Length: 302
Type: CDS
Source: GLEAN
Position: GCSC_160:299189..299246 (+ strand)
Length: 58
>GLEAN_3028 class=GenePrediction position=GCSC_160:298838..299246 (+ strand)
ATGGAAAATGAAAAATATCAACAACTTGCAACGTCGTCCATCGACACCGACACCGCCTCCGCCGCCGACCTCGCATTACA
CACGCCCGTCTCCGCCGCAGCCATGAGTTTCATGCCCGTGAACCCCCGTCCGATGCTCCAGGACCTCGTGGGCAAGCCTG
TCTCCGTGCGGCTCAAGTGGGGCGAGACCGAATACAAAGGCGCGCTCGTGTCGATTGACAGCTACATGAACCTGCAGCTG
TCGGACACGGAGGAGTTTATCGACGGCGAGTCCACCGGCCAGCTGGGCCAGGTGCTGATCCGGTAGGCTGGACGCTGTGC
GACGCTGCTGCACCCTTACTAACCCGGCCAGATGCAACAACGTGCTGTGGATCCGCGGCGACGAACGCGACACCAAGATG
GAAGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62