GenePrediction:GLEAN_3030 Details

Name: GLEAN_3030
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:308179..313638 (+ strand)
Length: 5460
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:308179..308207 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_160:308382..311871 (+ strand)
Length: 3490
Type: CDS
Source: GLEAN
Position: GCSC_160:311926..312588 (+ strand)
Length: 663
Type: CDS
Source: GLEAN
Position: GCSC_160:312655..313638 (+ strand)
Length: 984
>GLEAN_3030 class=GenePrediction position=GCSC_160:308179..313638 (+ strand)
ATGTCCTTTCGTGGCGACGACCAGCGCCGGTACGGCCATGTGCCTCCGGTGCAGTACCCCGTTGGATCTCAACAGTACCA
GCAACAGCAGCAACAGCAGCAACAGCAGCAACAACAGCAACAGCAACAATACCAACAGCAGCACCAGCAATACCAGCAGC
CCCAATACGAGTACGGGTATGATCGCAACCAGACCACTTCCAGCCAAGGAACCTTTGGCATCCTCAACAACGGATCCTAT
TTTGACGATGACCGTGATCAGCCGAGTGTGGCTCACCGCAGCGAGGACGAGCTGTTCTTCTCCGGCAACCCCGATGTGTC
CCCCTCACAGGCTGTCGTCTCGACCAGGCCGTCTGCTTATGGTGGCTCCCCCACGAACTCAGCCATGTCTGGCTACCAAC
ACCAGTACCAGACGCAGACGCAGCCGGCACCGTCTGCCTATAACCCCCAGGTCTTTCCGAGGTCGCAGTCGCAGTCTCTC
CCCTACCATCCCCACCCTTCCACCCGCCTGGCCTCGCCGACCACGTCCTCTGCACCGCCCTTTCCGTCGCCGCAGCAGAG
CTACACCCCAGCCGCTTACAACCCGGCCGCCTATGCCGGCACAAATGCGGCTGTGCCACAGCGAACGGCCACTCATTCTG
GGCACGGCAGCTACCAGAACAGCTACAATGCGCCGGCGGTCCAGCAGCCAGCCTTACCACCATCGCCTCAGTCGTACATC
CAGCAGCAGCAGCAGCATTACGCCTCGGGGGCCCACTACGCCAACACAGCGTCAACAACCATGGCGCCGTACGAGTCGGT
GTACACGGCGGACCCCCCAGGAGCGAATTCGTATTCCTCCTCGACTAGTGCCTACTCGGCGATCGAGTCCGTCTCGGCCC
CGATTACCTCGCCAGCCGCCACCGTCTCGAGCGGTGCATCAATCTCACCTTATGCCATGCAGAGTACCATGACCTCACAG
GCGCCTTATCCAACATATGGACATATGCCTTCGCACTCTGCTGGAAGCCATTCTATTAGTGGCACCGAGTCTGCTGCCTT
TGCCGGCCGTGTGGGCCGATCAGACTCCACCACCTCGCCGTTGTCATCTCCGCTCGGCCATAGCTCGTCGCCGCTCGGAC
TGCAGCGGCATCCTACCAACGCACCACTTCCAAGCCGCCCACCGATGGATAATGTCCTCGAAGAGTCGGCATGGCAGCAA
GGAGCGTCCGACATCGACGACGGGAATGTCACGCAGGACAGTCTCTTCCACGACATCGAAGCTGATTTGGGTCTGGACAG
CCCCGGTAACGGTTCAAATGGACGAAACGGTGAGGCATCTGAGGATCTCCTGTTCCGGCACAGCTCTCAGGCGTCAACGC
ATCCGAGCACCCATTGGTCGTCCGGAACATCCACCATTGGCCGAACGCCGTCTACTGCGTCTACGGCAACGAGCGCCTAT
CCGTCCGCCTCCACGAACCCGTGGGAAGAAGACAGCGATCCTGAGGGAGCGTTGGGTGTATACGAGATGTGGAAGGATGA
TCTGGATGCGCAGCGATTCAGCGTCAGCTCCGGCACAAGTGTACCAAGTGGCTATAACGGTATGCAAAGCCCCCCGCCGG
TGCAACGACCCGACGAACAGAATACCAGCGACTCTGACATCGGCACCGACATCACTTCATTTATAGGCGGCTACCCCGGC
AACCTGACTTATGGAGGCCAGTTTGGATCGGAGGGCGCAGACGATCTGGACCACCCTCCACAGTCAACAACACCACGCCC
ACATGGCAATGGGACTCAGTACGCCCCATTCAGAGAAGCTGAGATGGACTATGGGGGCACCGGTGGGCTCCAGAATCCTA
TTGGACATCGACTTAGCTTTGATAAAGACGACGAGCGTGTGTCTCTGGGCTCGGGCCTCAGTGGGAGCGACTCTCCACAG
AAGGATGACGGCTATCCAGACATGTTCTACCACCCGGGCATTTCGAACCGGCCGCTTCCAACACCCCCCTCCGCTCCTGT
AGAGACGAGCAACAGCAACGAGCTGATTCAGGCAAGACACGCGGCTGCAAGAGTGTCCTACCATCAGCACACGCTTTCTC
ACGGCGCGAACTCGCGGTCGTCTGTGTATCATGCGCAACAGGAATTGCAGCTGCAACAGCAGCTGCTGGTGGAGCGCTCG
ACGTCCATGTCGAGTCACAGCACGACGCCCGTTGTCCAAGTGCCCGGACGATCGCGCACCGATGCTGCCGAAGAGCGGAA
GAAGGCACAAAGGCTGTTGGCCGCACAGCAGGGCCTGCCGTACGATAGCTACGAGAGCAATAGCGCGACCTCGATGACGT
ACGACGTGATCACGCTGCCTAGCGGCCGGCGGCGCAAATTTGTGCCGTCCAAGCTGAGCCCTGTCGATTTCCGGCGCTGT
CTCGAACCGTGGGCGCTGAGCAGCATAGCTCGTTGGATCCGCGAGATGGCGGATGGCGAGCCCGACCTCAAGCGCAAGAC
AATCGAGGAGGGCCTTGTTGCGCTGTTTATCACAAAGGTGCCTACGATGAATGTGGCCGACGCCGAGACGCTGGCGGACA
TGGTGGCTGACTCGATGTCTCGGGCTGGCATCTTGATACCGGAAGAAGAATGGGTCAGGTTTGGGCCGGGTGAGATCAGC
GGCGTGCTGTGGCAGCTAACCGGCTCGGGCTGCTACGCTTCCCGTCTCCACGAGCACGAGACGGCCGGGCGCTGCTACTC
ACACTACTGCACGCGGACGCTGCGGAAGGCAGACTTGAACGGGCTGATGGCAGAAGAGTCGTCTAAGAAGGAGGACTGGA
TGACGTTCTACAAGATCACCGAAGAGATGCGGGCAGGGAAGCCACGCAAGGAAGTGGAGCGGCAGAACAACCTGCACGAG
ATCGTGACGAGCGAGGAGGACTTTAGCAACCAGCTGGAAGTGCTGCGGGTGCTGTACAAAGACCAGCTGCTGCACTGGAA
GCCTCCCATCATTCCGCCGAACCGGCTAGAGAAGTTCGTCGACACGGTCTTCGGCAAGGTGGAGTCGATGCAGCGGGTGA
ACAAGGACCATCTGCTGGCGCAGCTAAAGTACCGGCAGAACGAGCAGGGTCCCTGGATCATGGGCTTTAGCGACATTTTC
CGCGAATGGATCCGGAAGGCCAAGGACGAGTACATTGCCTATTCGGCTCAGTATCCGATCGCGTCCTTCACCGTGCGCAA
GGAGGCGTCGCGCAACATGCTGTTCCGGCAGTTCCTGGAACATGTCCGGAACAACAAGCGGTCGGACCGGCTGGGCTGGG
ACACGTTCTTGAAGGCGCCGATCACGCGGCTGCAGCGGTACTCGTTGCTGCTGAGCACGGTGCTGAAGAACACGCTGCAG
GACAGCGAGGAGAAGGTGAACCTTGCGCGAGCGATTGAGGAGATCCGGGCAGTGACAAAGGAGTGCGACCGGCTGGTGGA
CGAGATGGGCAAGAAGGTGTCGTTGCAGGAGCTGCAGAACCAGCTCGTCTTCCGGCCCGGCTCGCAGACAGTCCTCAATC
TCGACCATCTCGGGCGGGAGCTGCTGATGCAGGGCGATCTGCAGCGGATGGGATCGAAGGGCGTGCGCTGGGTGGACACA
CACGCGCTGCTCTTTGATCATTACTTTATCCTGACCAAGGTGATCGGGCCAAAGGATGGGAGGGGCGACAAGAAATACGA
CGTATCCAAAGAGGTGAGTGGAGGTAGTCTTCTTTTGGAGCTGCCCGAAGTGTACTGACGCCGTTAGCCCATCCCGATGC
CTCTGCTTCTCCTGGAGAGCATGAACGACGACCCGATCTCGAAGCAGAAGGGCCTTGTTGCCACGCCGCTGACAAGGTCG
ACTGTTGCCTCTGTGTCGGACACGATGCTGAACAAGGTGTCGTCCATTGCGCCAAGCCGGCCCGAGTTGGACCACGCAGC
CACCAGCTCGTCGATCAACTCGCTCGCGCGCCTGGCGCCGGGCACGCAGAGCGAGGAGGGCAAGACGCTGTATCCCTTCC
GGGTCAAGCATCTCGGCCACGAGATCTACACGCTCTATGCGACCACGCCACAGAGCCGACAGGACTGGTGTGCCAAGATC
GTGGAGGCCAAGACGCGCCACGCACGCGCGCTGGCCGAGCAGAATGCCGAGCCGTTCCGGCTGCGAGTTCTCTCGGACTG
CGGGTTCGCGTACGACTCGATCACGGCGTCGTCGAAGCTGCCGAGCGTCTCGATTCCGGGCACGCCGCTCGACCGGTCGA
TCCGTGAGATGGGAAAGGTGTTTGGGACCGGCCGGGCACCTCCGCCGGTATGTCGGGCATCGGTGAACTGTGCCACCGGC
TTCACCGCGTTTGAGAAGTCGATCATTGCCGTGGGCACAGACTTTGGCGTCTATATTTCGGATGCCGGAAATCCGCGAGG
CTGGTTAAGGGTGAGCCTTTTTTTTTTCTTGCTTGCTTCTGCTTCTGCTGCTTCGGCCTACGCTAACACCCTGCAGTCGG
TGCAGCTCAACAAGGTGACGCAGATAACGGTGCTGGAGGAGTTCTCGATCTGCCTGATCCTGGCCGACAAGTCGCTGATC
TCATACCCGCTGGACCTGGTGGCACCGGTGGGTAACTATCCGGCTTCGAATCACGACAGCCCGCGACATGCGCCGCAGCG
GCTGGCCAAAGACGTCAGCTTCTTCGCCACGGCCCGCATGAAGGAGCGCATGCTGCTCTTCTACAAGCGCAAGGAAGGCA
TGCACAACACGTTCAAGGTGCTGGAGCCGGTCTTCCAGAAGGCGTCGGAGAAGAAGAGCCGGTTCTTCGGGACGCGCAGA
GGTGCAGCCGGCGCCACAGAGACATTCCGCGACTTTGACGAGTTCTACCTGCCGATCGAGTGCTTCTCGCTCAACCTGTT
CCAGTCGTATGTGGCCGTATCGACGGCCAAGGGCATCGAGCTGCTGACGCTGGACCGCAAGCAGCCGATGTCGGTGCCGT
GTGACTTGGCGCTGCCGGCGATCGCCAACATTGCCGCCCGGCTTCGCGACCAGCGACCACTCGGCATGTTCCGGTTAAAC
GACCAGGAGTTTTTGCTGGCTTACGAGGATTGCGCCGTCTACGCCGACAAGCACGGCGAGGTGTCGCGCACGCTGATCAT
GGAGTACTCAGGCCGCCAGAAAAAGGCCAAGGCCGCGACCATGTTCGGCCAGTATCTGTTGCTGTTCAACGAGGACTATG
TGGAGGTGCGCAATGCCGAGAACGGCCGCCTGCGCCAGATCATTGCCGGCATCGACGTGCGCTGTCTGGACTATGGGTTT
AGAGGACCGACGGGCGGCGACAACGCGTCGGCCACGACCCAACTGTCCGCACCGCTGTCGAGCAGCCAGGGCCAGATGTC
CAACGGCTCCGTCAAGATCTGCATGGCCCATCCGGAGCAGCCGGGCATGCAGATCGTGCTGGAGCTGCTGCTGAATGATG
GCCACTCGGAGAAGTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62