GenePrediction:GLEAN_3031 Details

Name: GLEAN_3031
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:314307..320816 (+ strand)
Length: 6510
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:314307..314653 (+ strand)
Length: 347
Type: CDS
Source: GLEAN
Position: GCSC_160:314725..317512 (+ strand)
Length: 2788
Type: CDS
Source: GLEAN
Position: GCSC_160:317588..319806 (+ strand)
Length: 2219
Type: CDS
Source: GLEAN
Position: GCSC_160:319851..320484 (+ strand)
Length: 634
Type: CDS
Source: GLEAN
Position: GCSC_160:320539..320670 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_160:320748..320816 (+ strand)
Length: 69
>GLEAN_3031 class=GenePrediction position=GCSC_160:314307..320816 (+ strand)
ATGAAGTCCACCCACGAAGTGTACGCGGAAATCATTGCCTCTCACCAGGAGCTGGAACGTATACCGACCGACGTGCACCT
CTTCTGTCCCCGTCTTAGTGATGACGATCAGGAGGACTACGACGATGTGGCTGGCTCAGACGCGGACAAGCTGAAGAAGA
TTGAGGATGGCCAGCGCCGTCTGCAGCTCACGTCGTGGGCATCGCTCATTCTGGGCATCAACCGCGACCAGGCCGACCGC
TGGCTCCCGGACTGGATCCAGCGGACTGAGTCCTTCCTCGTCAAGTGTGACGGCTGTGTGCGGGCGTGGCACATGGGTCG
GAAGGCGTTGCGAAGTCGTCTGCTGAAGTAAGTTTACCCTTTGTCTCTTTCGCTAACTCGTCCCTTCCACTTTCCTCTCT
TCCCCGCTGACTAATCAGAGAGTTTGACGAAGAAACAACCAACATCATGGAAGGCCGGCTGCACGACTATGACACGGCCC
GCATCGACCGTGGCCTTCGCCAAGCCGTCGCCATCCTCGAGCAGCACGGGCCCATGTCGTCGGCCAAGCTGGTAGCCATC
GACGCCACGGCCGTGCTGGCATTTTACGAGGCCCTCTGCTGCGTCGAGTACCTCAGCCTGCCCGAGAACCGACGCCTGTT
CAACATTGTGTTCCAGAAGACACAAGAGAAGAAGCCACTCAAGATCGCGTCGGCCGTGATCCCGACCATGACCGTGTTCC
TGTTCCAGGCCGACCCGCTGCGCAACCGGTTTGCCCGCACGGCCTGGGAACGACGGCCGGCTCAGTCGCTCACGCCGGAG
CAGTTCGAATGGGCCGTCAGTGACCATCTGGCCGATGCCATTGACGCGGTCAGCAAGCCAGATGCGGCCGACGCGGCCGT
GCAGCTCTTCTGGGACGGTTTCCTTCTGCTGCTCGACGCCATGAGCGAGGACGTGGTGCTGCACTGTCTGCGCGGCATGC
AGATCCCCATGGACGTCTACCAGCTGGCTGTGCTGCATCTGGACCGACCGGCCGACGGGGTGCTGGCCGGCAGCTTGCGC
GCGCTCTGTGCCCTGATGGACAAGTCGGCCAAGGCGTTTTGGGATGCGCTCTCGCGCATGAACCCGCCGCAGCTGCCCAT
GTTTCTGTGCCGTAGCCCAGCCTTTGCGCCCTTTCTGGCGCGCTCCTTTGAGGAGGCCATGCAGCTGGTGCCCGACAGCA
CTAGCACGCGCGCCCGTATGCCGCTGTTGGTGGCCTTTGTGCGCTCGCTGATGCGCTCGCTCAATCGAAATCAGCGCTCA
GACGTGTGCGACTACCTGCTGTCCGTCTTTCTCACCAACACAGCTGACCCGGCCGTCACGGCCACGCGCGAGGGCCACTC
CACCTGCATCGTAGCCGGCCTGACCGCCCTGCAGATGACCCTGGACGGCTACCTGGACGCCCGCTACCGCCTGACGTCCG
AGAGCGCTCTGTTTGTCACCACCGTCATCAACAGCGCGGTCAAGCACCACGACTACGTTGTGCGCTCGGCGAATCTGCAC
CCCAGCGACCGCTATAACATCGGTTTGTCGCAGGCGGCTGTTGGTGTGGTCGAGTCAGCCCTGGCCCTCGATACCCGCGC
CATCCAGGACGAGTGGCGATCGCTGCAGCAAAACGCCCGCCTGCCACCGGGCAACGAGCGCCGGTCAGCCCAGCTCTGGC
ACGGCTTCCGCACAGCTCTGGGCCCCGGTCGCCTCGACCTGGCGCGCGTCATGCTCACGGCCACGCTGTCGCTGCGCGGA
ATCCAGCGTTTCTCGCCCAAGAAGCGCCAGGTCCAGGTCGAGGACGGACCCCGACGGCGGTTTAACGACGAGCTCGAGCC
GGCTGCCGAGGCCATTGCGCAGACCATTGAGCGCGTCGGCGAGAGCCTCAGCTGTGCCGACCTCAAGACGCTCTGCTCCG
ACACGCAGAGCCGCTCCATGGATGCGGTGGCCTCGACCCTGATCCACGCCGAAGACGCCATCCGCGAGGCCGGCTTTCTG
CTGGTCGGTGCCATTGTCGACGACGACGGTGGCAGCCGGTCCGAAATCATCGGCAAGGTCGTCAGCGAGCTTCCGGTTCC
GTTCTTGACGTCGTTTGCCGATGCCATCGACCACCTGACCGGTGGTGAGGGCCGACTGGGCAGCGCGTCACCCTTTGAGC
CGATGCGCCACATCTACCGCTGCAGCAAGGACGTGCTGGACGGCCTGTGTGACTCGTCTGCCGGCCTGTTGCGGTCGCGG
ACGCTGACGGCAGAGGAGCGCAAGGCCGTCAAGCGCTGGTGGACGATGGAGTGGCAGTTTGTCGACCACTCCTTTCTTCG
TGCGCGCGCCTGGAGCGAGGATGTGGAAAAGTCGGGCATGGAGAACTACTGTCGCGACGTCATGGAGTTTGCGCGGCTGC
TGATGGCACAGGACGGCTTGATCGCCTCGGCCCTGGCCGAGAATGGCGGCTCGACTTCGATGGAGCCGTTTGCGCACAGC
TCGACGATAGCAGCGCCACCGTCATCGTCGTCGTCCACGAAAAACGACAGTGCTATGCGTGAGGTGCTCGACGCGCCGCA
GAAGCACTCGATGGGCCTGTTTGAGATGATCCAGCTTCGCGACCAATACTTGGTGGGAATTATCGTGGACATCCTGGTGA
AGCTGTTCACGCGGCTCAAGGAGTTCAACCTCAGCTTCCCCGACCGGTTTGTCAATGCGATCCGCAGCACGTACACGGCG
CACCCGCAGATCCGCAACAAGTTCAAGGTGAACACCAACATGAACGACACGCAGCGGGCCGAGCTGATGAAGGCGATTGG
CGACGGTGGCGATGACGATGACGACGAAGATGTGGAGATTGTGTCCTGGTCCTCGGCGACGGTGGCGGGCAAGTCGGCTA
AGAAGCGGCAGACCACGATCGAGGCCTGGTCTCGTGGTGGCAGCGGGACAGTCAAGACAGCCTCCTCGTCGCCGTCGCCG
GCGCCGTCGGTCTCTAGCAAAGAGGCGGCATCGCAGCTGACGCCGGGCCTGAACAAGCACAAGGCGCTGCTGGACCGGAT
GAAGGCGACGGCGGCAGCCAAACCGGACCAAAAGGCGCTGCTGGCCAACCGGGCGGCGATCCGAGAGGCTCGGCAGCGAG
ACAAGGCCGAGATCGAAAAGCACAAGGCCGAGGCGATTGCACGTGCGCGAGCGCTTCGAGCAGCACCGGTCAAGAGCGAC
ATCATGGTGGACAGCGCATCCGACGAGGAGGAGGAGGACGATGACGACGATGACGACGGAGCGGACGCGCTGATCCGACA
GAGCCGCAAGGGCGAACAGCTGCTGGACGAAGTAGAGCGGCGCAAGCGGGCGGCGATGAAGCAGATGATGGCACGCATGC
CGGTCAAAAAGATCAAGCAGCAGCGATCGGCCAAGGACATGCGGGCACGCATCATCCCCAACATGGACCGGCTGCACCAG
GCGATCCTCGAGTGGGACATCTTCCACGAGGGCAACGACCCGCCGTCGGACGGGTTCCAGTGTGTGGCCGTGGCCGACGA
CTACATGTCGCCAGCTGAGTACAAGAAGACCTTTTTCCCGCTGCTGATCAACGAGGCCTGGCGGTCGTTTGTCACGGCCA
AGGAGGAGAGCACGGCCAAGGCGTTTGGCGTCAAGGTGGTGACGCGCATCTCGGTCGACAACTTCCTCGAGGTCAGCACG
CTGATGCCGGCGGCAGCTAATCGCGAGCGGCTGCTGGGCGAGGGCGACATCGTGCTGCTGTCACGCGGAGCGGACCCACT
GACGAGCCGTGGTGAGCCACACTGTCTGGCGCGTGTGTGGAAGCTGGCAATGAAGCGGGAAAACTGCGAGGTGACGTATC
GGCTCAACAGCCGGCGCAACCTGATCCTGCCGGTGCTGCTGCCGGGTGCCGAGTTTCGGGCAGTGAAGATCACCAACATG
ACCACGATCGAGCGCGAGTACGCGGCCCTGGAGAGCCTGCAGTACTACGACCTGATGGACGAGGTGCTCAAGGCGGCACC
GTCGCCGATGCTGACGTTTGGCGACGGCGCCGTGGCCGAGGTGCAGCGCACGTATGAGCTCAACCGCGGCCAGGCCGTGG
CCATTCTGCACGGCAAGGCCAACGACGGCTTCACCCTCGTGCAAGGGCCTCCGGGCACGGGCAAGACGAAGACCATCGTG
GCCATGGTGGGCGCGCTGCTGACGGGAACGATCAAGACGAACGCGGCAGCCGTGGCGGTCAGCCGTCCGGGGGCCAACGG
TCACGGTGACAGCACGACGAAGAAGCTGCTGGTGTGTGCGCCCAGCAACGCGGCCGTGGACGAGCTGGTGCTGCGGCTGA
AGATGGGCGTGCGAGAGACAACGGGGGCGTTGCGCAAGATCAACGTCGTGCGACTGGGCCGGTCGGAGGCGATCAACTCG
GGTGTCAAGGATGTCACGCTGGAAGAGCTGGTCAAGTCGGAGATCTCGCGGCAGACAAAGGTGTCGTCGTCGTCTGGTGG
TGGTGGTGGTGGTGGTAGTGATGCTAAAGAGCAGCCCGTCAGCGATCGGGAACGGATGCACCTGCGTGCGGGCGAGATCA
AGGCCAAGGTGATGGAGCTGATGCCGGCGTTGGAGGCAGCCCGACGAAGTGATGATCGCGACGTGATGAACCGGCTGCAG
CGCGAGCACGACGAGCTGCGGTCGGAACAGCGACGGATCGGCGCGCAGATCGAGCGCGACAAGGAGTCGGGCAACACGTA
CGCACGCGAGACCGAGATCAAGCGGCGACAAATCCAGCAGAAGATCCTCAACGAGGCCCACGTACTGTGCGCAACGCTGA
GTGGTAGCGGCCACGATATCTTCAAGAATCTCAACGTCGAGTTCGAGACGGTCGTCATCGATGAGGCGGCCCAATGCGTC
GAGCTGAGCGCTCTGATCCCGCTCAAATACGGCTGTGCCAAGTGCATTCTGGTCGGTGACCCGAAGCAGCTGCCGCCAAC
GGTGTTGTCACAGTCGGCTGCGCGCTATGGCTATGACCAGAGCCTGTTTGTGCGCATGCAGCGCAACCGCCCGCAGGACG
TCCACCTGCTCGACACCCAGTACCGCATGCATCCCGACATCAGCCGCTTCCCGAGCCGGCAGTTCTATGAGGGGCGTCTG
ATCGACGGCGCCGACATGGCCCGTTTGCGTGCCCAGCCATGGCATGCCAATCCGTTGTTGGGTCCGTATCGTTTCTTTGA
CGTCAGCGGTGCTCAGGAAAAGGGCCACCGTGGTCGATCGCTGGTCAATGAGAACGAGGTCGGCGTGGCTCTGCAGCTGT
ACCGCCGCTTCCGTGCCGTCTATGGCAGCGGTCCGCAGACGAGCCGAGGAGACGACGACGAGGCCGGGCCCAAGATCGGC
ATCATCACGCCGTACAAGGCTCAGCTGCAAGCCCTGCGCTCGCGCTTTTCCTCCCAGTTTGGCGACGACATCCTGCAAGC
GGTCGAGTTCAACACCACCGACGCCTTCCAGGGCCGCGAGTGCGACATTATCATCTTCTCGTGTGTGCGTGCCAGCCCGA
CCGGTGGCATCGGCTTCATGACAGACATCCGCCGCATTTGAACGTCGGTCTGACCCGAGCGCGCTCGTCGCTGTGGATCT
TGGGCGACTCGCGGGCTCTGCGCCAGGGCGAGTTCTGGCACGCCCTCATCGAGGATGCCAAGGGCCGTGGCGAGTACACT
GGCGGTGATGTGATGGGTTTGCTTCGAAATGGTGGTGGAGGTGGCAGACAGGTTGAGAAGCCGAAGCCGGCAATGGAGAA
GCCGAAACAAGAAAGGCAGAGACCCGTGCAGCCCGTGCAGACTGCACGTAAAGCAAGCGGTTCCAGCTGGTCGACCCCTT
CGCGGCCAGTAGCCGCAGTCAAGAATAACAACGATGACGATGAAGACGACAGCTATTCGCCTCCGCCAGCCATGTCGCCG
CCCAGCCAGCCGCCACGCAAACAGCGACCGCCACCGCCGATGCTGCCGACCACATACACGGTAGTCGACCGACCAGGACG
GCCAGCTCCGGCGCCGTCCGACATCGCCGGCATTGGCGGCATCAACGAGCGCGGCGAGCCATTGCCGACCGGACCACGCA
ACACGGAGCGGCCGGTGGTGCAAAGCGGTCCAGCCGTGTCCCTCTCCAACAAGAAACGGCCGCACGAAGAGGCGGCCGAG
ACGCAGCCATCAAAGCGGGTAGGTCACGGCACACCACACACACACATGTTCGAATCTTGGCTGACCATGCAGACGGCCCC
CGAAGCAATGCTGCCGGCGAGACCGCCGCCACGACGGCCCACCGATCCATCGGCCATGCAGGTGCTCGGTATCGACGAGC
CATCGCAGGCACGACCGCCGCCACAGGCGCCGCGAGGACCGAGGGTGAGTTTCTCTTTCGTTCTTTTGTTTTCTTGTCGG
ATTTTTTGTAGCGAGCAAAGAACGAGCAGCTGACCGGATAGCCACCGATGCGACCCAAGAAAAAGGGACCGGCCGATCCA
TTCATCAAGAAGAAGCCGAAGCGGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62