GenePrediction:GLEAN_3032 Details

Name: GLEAN_3032
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:327387..330563 (+ strand)
Length: 3177
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:327387..327584 (+ strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_160:327645..330563 (+ strand)
Length: 2919
>GLEAN_3032 class=GenePrediction position=GCSC_160:327387..330563 (+ strand)
ATGACGTCGACGGAGACACGTCACAGGCGGGACTCACGTGACCTCGCGAGGGGCCAAAAGCTTCCCGCAACGGATCCGTG
CAGCATCCGTTCACCAGCCTTCCGCACTTTGCGCCATGGTCTTTCAGATGCAGAGACGCCCCACATGTCGTCCTCGGTGG
TCAGCGCACCGCAGCCGGTGAAGCTCTCTCTGCCTTTGGTGCGTTCGGATCCAGCACTCGTTGCTTCATTGCCCCCATTG
CTCCCATTAACAGGTTAGGAATACCAGCAGAGCCTCTTCCAGGAGCTGCGGGCTACCGATGAGCTCGTCGTCCTTGCGCG
CGGCCTCGGCCTCATGCGGCTGGTCACCAACTTGCTGCACTCGTACGATGCGGCTGGCAATAACCTGATCCTCGTGGTCA
ACGCAACCGAACGTGAGAACGGCTGGATCGGCGAGGCCCTAGCCGAACATGCGGCCATCAGCATGTCGCCGCGGGCCCGC
GGACTGACGGTAGTCAACACCGATTTCACCACCGTGGGCACGCGCGAGAAAATGTACGCGGCTGGCGGCGTGTTCAGCAT
CACGTCGCGCATCCTCGTCGTCGACCTGCTGACGTCGCTGTTGGACCCGGCCTCGGTCAGTGGCATGGTGGTGCTGCACG
CAGACCGCGTCGCGGCCACATCGCTCGAGGCCTTCATCCTGCGCATCTACCGCCAGAAGAACAAGCACGGCTTCCTCAAG
GCATTTTCGGACAGTCCCGAGGCCTTCTCGAGCGGCTATGCACCGCTGGCTACCATGATGCGCAACCTCTTCCTGCGCAA
GGCCTCGCTCTGGCCACGCTTCCACGTCACCGTGGCAGCCGGGCTTGAAGGCCGGAAGCGGGCCGAGGTGGTCGAGTTCG
AGGTGCCCATGACCGAGAACATGAAGGACATCCAGAACGCCATCCTTGAGTGCGTCGAGGTCAGCATCCACGAGCTGAAG
AAGAGCAACCCGGGCCTGGACATGGACGACTGGAACCTCGACAGTGCCCTGCTTAAGAATTTTGACACTATGGTGCGGCG
CCAGCTCGACCCCAACTGGCATCGCGTCAGCTGGAAAACCAAGCAGATTGTTGGCGATCTGACCGTGCTGCGTGGTATGC
TGCACTCCATTGTGGCCTGCGACGCCGTCGCTTTCCTGCAGCGCCTCGACACCATCCACGCCGCCCACTCGCCGGCTCCG
GGCTCGACACGCCAGACCCAGTCGCCCTGGCTCTTCCTCGATGCCGCCCAGACCATCTTCGACACGGCCAAGCGACGGGT
GTACACAGGCAAGCACGATTTTCGTAGTGCCTCTAGCACTGGTACTGCTGCTGTCACCACCACACTGCGCCCAGTGCTGG
AGGAGCAGCCCAAGTGGTCGGTGCTCGCCGATGTGCTGGCCGAGATCGACCGCTCGCTCTACCTGGAGCCGATGCCGCGC
GATGACTCCAACGGGACGATCCTGATCATGTGCGGCGACACAGACACATGCCGACAGCTGCGCGACTTCCTGCAGACCAT
GCACGTGCGACCGCGCACCGAATCGCGTGTCGAGGAGTTCTTTGACGCCGACGAGGACCGGCCGTCGGGTGCGTTCATGA
TGCGGCGCAAGCTGCGCAACTATCTTAAGTGGAAGAGCGAGTTCGCCCACGTGAACGCGGCGCTCTTCGCCGAGAACCAG
AAGGCGCTGAGCGGGGCCGTCGATCCGCGGACAGGTCGGCCAGCCGGCCAGCGTGGCGGTGTGCCGCCGAACAAGCGACG
CCGCGTGCGAGGAGGCGGCGGTATGGGCACAGCGGCTGCAGCATCGGCCATTGCAACTGCGTCGGTGACCCACGCAGCCC
GGACGGCCAACGGCAGCATCGCGCAGTACTTTGAAAAGCCGAGCGAGGTGGCTGACCTAATGGCCGAGATCCAGGAGGCT
GAAGCGGTGACGGCAGGCGAGGACGGTGGGCCGGACGGCAGCAGTCGCGCGGCCGAAGCAGCTGCAGCCCAGCAAAAAGC
AGAGATCCTCGCAGCCATGGCAGACCCGATGGAGAACATGGAGGACTACTACCAGCTGTATGAGATGAGCGATCTGGTGG
TGATCCAGGCGTATGACGGCGACCAGGACGAGCACGTGCTGGAGGAGGTGAAGCCGCGGTACATTGTCATGTACGAGCCA
GATGCAGCTTTCATCCGGCGGATCGAGGTGTACCGGTCGTCGCACAACGACCGCAACGTGCGGACGTACTTTATGTACTA
TGGCGGGTCGGTCGAGGAGCAGAAGTACCTGTCGGCGGTGCGGCGCGAGAAGGACGCCTTCACCAGGCTGATCCAGGAAC
GAGCATCGATGAGCGTGGTGATGACGACAGACGTTTCGGCGGCCGGTAGCGAGGACGCGCAGGAGTCGTTTTTGCGGACG
GTCAACACACGCATTGCCGGCGGCGGACGGCTGGCCGCATCAGCGTCGGCCCAGCAGCCGCGGGTTGTCGTCGATGTACG
CGAGTTTCGCTCGTCGCTGCCGTCTCTGCTGCATGGCCGCAGCATGGTCGTGGTGCCGTGCATGCTGACGGTCGGCGACT
ATGTGTTGTCGCCACACATCTGCGTCGAGCGCAAGTCGGTCAGCGACCTGATCTCGTCCTTCCGAGACGGCCGTCTCTTT
GGCCAGTGCGAGTCCATGTTCCAGCACTACCGCGACGCCATGCTGCTGATCGAGTTTGACCAGAACAAGTCCTTCACGCT
CGAGCCGTTTGCCGACTTGCAGCACGGCCCGCCCTCGATTGTCGCGCCCGCTGCTGCTGCTGCTGCCACCGACCTGCAGT
CCAAGATCGTGCTGCTGACCCTCGCCTTTCCGCGCCTGCGCATCGTCTGGGCCTCGTCGCCCTACGAGACTGCCGAGATC
TTTGAGCGGCTCAAGGCCCAGGAGCCCGAGCCCGACCCTGTCGCCGCTGTGCGTGCCGGCCTCGACCCCAACGCCCGCGC
CGACGACCAGCCCTTCAATCAGGAGCCTCAGGAGATGCTGGCTGCCGTGCCTGGCGTCACCCCCCAGAACATCCGTACCC
TCGTAGCCGAGACCGAGAGCATCCAGGCCGTTGCCGTCATGGACGCCGCTGCACTCTCGCCGCTGGTGGGCCCGGAGTCG
GCGCGGCAGATCGAAGGCTTCTTCAAAAAGGACATTATCGAAGATGCCGGGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62