GenePrediction:GLEAN_3034 Details

Name: GLEAN_3034
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:341263..342356 (+ strand)
Length: 1094
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:341263..341575 (+ strand)
Length: 313
Type: CDS
Source: GLEAN
Position: GCSC_160:341632..341692 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_160:341764..342192 (+ strand)
Length: 429
Type: CDS
Source: GLEAN
Position: GCSC_160:342245..342356 (+ strand)
Length: 112
>GLEAN_3034 class=GenePrediction position=GCSC_160:341263..342356 (+ strand)
ATGTCCTCTACTACGTACAATCCGGCCAACTATGTCAGCTACGGCCCCGACACCAACTGCACCCTTGCAGTATGTCCCCT
AGATGCCAGTGTCCTGGGATATCGGCCCGCTCCCGCGGCCAGTGGCATCTTCCTCGCCTTCATCAGCCTGTCCATGATTA
TCCACGCTGTCCAGGGCATCGTTTGGCGCCACACATTGCGCAGCTTTGCCATACCCATCATCATCGGCTGCATTGACGAG
ATCATCGGCTACGCCGGACGCGTCGTCCTTTATAACAACCCATTCAGCTTTAACGGCTTCATCATCCAGATCGGTACGTC
TGAATTTCCCACCTCTCGTTTTCCTGTCTCCCTGCTCACACGGCTGCAGTCTGCATCACCACGGCCCCCGTTTTCATCTG
TGCCTCCATCTATGTGACGCTAGCTCGAACGTGAGTGCTTCTCTGCCCCCCCCTCTTGGCCTTTGTTCTGGAGTATGCAC
TGCTAACACGAGCTCCCATAGCATTGAGTACATGGATGCCGGTTTGGCCCGCTTCCACCCCAAGTACTTCTACTGGTTCT
TCATTCCCTGCGACATCGTCTCGCTCGTCTTTCAGGCTGCTGGCGGCGCCTTGTCGTCCATCACCAGCGGCGGGAATCAG
ACCGGCGTCAACCTGTCACTTTTCGGCCTGGCCTTCCAGGTCTTCACCCTGGCCATCTTCATCGGCTTTGCCGGCGACTA
CCTCGTACGCTACTTCGTCGCGAGCCATGATGGCAAAGAGGCTGAGATCCGCGCTGCTCCACGCACCCGGCTTCGCATCT
TCCTTGTCTTCCTGACCGCTGCCGTCATCTTCATCCTCGTCCGTTGCATCTACCGTATCGACGAGCTGAGCGATGGCTAC
ACCGGTCCCATGATTCGCAAAGAGGGGCTTTTCTACGGACTTGAGAGCGTGTAAGTTTTTATTTTATTTTTGCGCTTTTT
CTACTTGCTAATCGCCTTCCAGAATGATCACTCTCGCTCTCCTTTGCCTCAACGTCAGCCATCCAGGCTTCGGCTTGAAG
CATGAAGCGTCTTCTCTAAATTTTCAAATGGCCGATGTGAGCTCGTCGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62