GenePrediction:GLEAN_3035 Details

Name: GLEAN_3035
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:347920..348524 (+ strand)
Length: 605
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:347920..347971 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_160:348048..348074 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_160:348139..348168 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_160:348231..348321 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_160:348386..348524 (+ strand)
Length: 139
>GLEAN_3035 class=GenePrediction position=GCSC_160:347920..348524 (+ strand)
ATGCCTCCCGTCAGCACCGGCCATGCAGTGGGCCCTTCAACCTCCGACAAGCGTGAGTAGCCGCTTCTCCAAAGGATGCG
AGAGATGTACATTGGGCTGGCTGGCTTGGCTAACACGATCTTTTCCAGTCAAGATGGGCGCCATGATGGGTGGCAGTATG
TTGCTCCCGTTTGCAACCCGACGTGAAGAGCGGGGGTGTCTTGGCTAATTTCTTACCAGCTGTGGGTGTAATCATTGGAT
TTATCTACGGTATGCAGCGGCGAGGTGGTGGTTGCGACGTGCTCTATGGCGAGAAATGCTGACCGACACAGGAACCGTCA
ACATCTTCCGGTACGGCGCCGGCGTAAACGGCATAATGCGGACTCTGGGCCAATATATGGCGGCGTCCGGGGCGACTTTT
GGGTGAGTGTGGCTCTGGCAGTGTTGACCGTGGCTCGTTGTGTTCTGTGCTGATATGTTCTCGCAGATTCTTCATGTCTA
TCGGCAGCGTCATTCGTAGCGACTCCTCTCCGATTGTGCAAGAAGCCTACGCAAATGCTCGTCGGCGGCCATGGATAATG
GCTGCTGAGACAGCCTATCGGCCACGGCCAAACCGTACGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62