GenePrediction:GLEAN_3036 Details

Name: GLEAN_3036
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:350107..352116 (+ strand)
Length: 2010
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:350107..350183 (+ strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_160:350344..350791 (+ strand)
Length: 448
Type: CDS
Source: GLEAN
Position: GCSC_160:350899..351719 (+ strand)
Length: 821
Type: CDS
Source: GLEAN
Position: GCSC_160:351774..352116 (+ strand)
Length: 343
>GLEAN_3036 class=GenePrediction position=GCSC_160:350107..352116 (+ strand)
ATGGGTTGGTTACATGGGCTCATCGTGGGTCTGCTGCCGCACCTGACAGCAGCACTCTCGCAGTCCCAGACGAACGGGTG
CGTTGTCGTTACATCCCCTCTGTCCGCTGCTGAGTGCAGTTTTCTACCCCAATGACTGACTGTGGCCAAGAGGATCGGTG
TTTGGTACCAGGTCAGCTCCAAGGCTGCCGCACTTTCTGACGAACAACCCGCTGCCACAGGGCTTTCCCTAGGGAAGCCT
GATCGCCAACGGGACGGATGCCTATGCGAACTTTCCGACCACTGGCGTGATCCGGTCGTATGAGTGGACCGTCAGCCGCG
GGACCCTCGCTCCAGATGGCTACGAGATGCCGGTGATCCTGGTCAACGGGCAGTTTCCCGGTCCAACCATCGAAGCCAAC
TGGGGCGACACCATCCAAGTGACTGTGCACAACAAGATCCGAGGCCCCGAAGAGGGAACTGCCATTCACTGGCACGGCCT
GCCGCAGCAGGGAACGCCCTGGGAGGACGGTGTGCCGGCAGCGACGCAGTGCCCTATTGCACCCGGCGCGTCCTTTACGT
ACCAGTTCCAGGTGACCGTGTACGGCACCTCGTGGTACCACGCGCACTACTCGGCGCAGTACGGTGCCGGTCTCCTCGGG
CCGCTTATTATCTACGGTCCCACCGAGGAGCCCTACGATGTAGACGTGGGCCCAATCCTGCTAAGTGGTGATGATGGCCT
TCTCCTCTCCCAAGACGTTCTGGAGGCCCAGCTGACTCATCCCCAACACGTGACCAAACTGGTATCACACAGACTACTAC
ACGGTGCTCGAGGATGCTGGCGCCCGGCGGCCAACCCGAGGTCTCGTCGGACAACAACCTGATCAACGGCAAGAACAGAT
TCGACTGTGCGACAAAGGCCGCTGGCGACGACACGCCCTGCACCAGCAATGCCAGCCAGGCCCAGTTCTTCTTCGAGGCC
GGCCGGGTGCACCGCCTGCGTCTGGCCAACACCGGTGCCGAGGGCCTCCAGCGGTTTTCCATCGACGGCCACACCCTCCA
GGTTATCGCCTATGACTTCGTGCCCATTGAGCCGTACGAGACCAAGCTGGTGACCCTGGGCGTTGGTCAGCGCGCCGACG
TGCTCGTCACGGCCGACCAGGGCACCGCCAATACGTCTTCGTCCTTTTGGATGCGCAGCAGCATCGCCTCCTGCTCGACG
GCCAGGCAGCCACGCGCCTTGGCGGCCGTGCACTATGTCCAGCCGTCGAACACGACAGCAGCTTCTGTCACCGCTGTCGC
ACTCCCTGTGCCGTCGAGCTCGCCCTGGAGCGGTCCTGATGTGCCCGATCCCAGCGTCTGTGCTAATGACGACCTGCAGC
TCACGCGTCCGCTCTTTGCACAGCAGCTGCCGGCGGCCAGCTGGACCCATGACTTTGATGTAGAGCTGTTTGTCAACGGG
TCCAATGTGACGCTGTGGAAGTTTGACAGCGTCAGCTTCCGCGGCGACTACAACGCACCGACTTTGCTGCTAGCTAGTCT
GGGCAACACCAGCTGGCCGGAAGAGTGGAATGCCCGGAATCTGTACACGAGCACATCGGTGCGGATGATTGTCAACAACC
ATAGCCCATCCCAGTACGTGGCGGAAATAGACAGACAGACAGAGAAACAACAAGTGCTGACTGATAGACATCCCATGCAC
CTGCATGGAAGCGACTTTTACGTCCTGCACGAAGGCCCCGGCGAATGGGATGGCACCATCGTGGAATCAACCAACCCGAT
GCGTCGGGACGTGCAGATCGTCCGCCCAAATGGCCATCTGGTGCTGCAGATGAACGCCGACAACCCGGGCGTCTGGCCGT
TCCATTGCCACATCGCCTGGCATTCCTCGGGGGGCTTCCTTTCTCAGCTCATCGTGCAGCCCAGCAAACTCCAGGACCTC
CAGATCCCCAGCGTCATGGCGCAGACCTGTCGCGACTGGGCGTCTTGGACCAAGACACATATCCCTGATCAGATCGACAG
TGGGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62