GenePrediction:GLEAN_3037 Details

Name: GLEAN_3037
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:353925..357500 (+ strand)
Length: 3576
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:353925..353997 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_160:354072..354526 (+ strand)
Length: 455
Type: CDS
Source: GLEAN
Position: GCSC_160:354604..354800 (+ strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_160:355010..355643 (+ strand)
Length: 634
Type: CDS
Source: GLEAN
Position: GCSC_160:355812..357500 (+ strand)
Length: 1689
>GLEAN_3037 class=GenePrediction position=GCSC_160:353925..357500 (+ strand)
ATGGCTGTTCACATTAGCTCTGCAGCCCAGTGGCGCCAGATTCTCAGCTCCTCGAGCATCGTCGTGACCGACTGTGAGTC
TCCTGTCCCTGCTCTCTCTCTCTTCTACTAGTCTCTCGAGGCTGACAAATGGCTTGCTTGTCTTCAGTCTATGCCGACTG
GTGCGGCCCCTGCAAGATGATTGCGCCGACGTTCGAGTCGCTGGCCACCAAGTATTCCAAGCCCAACCGGATCACCTTTG
CCAAGGTTGATGTCGACAACCAGCGCGAGGTCGCCCAGCAGTACGGCGTCCGCGCCATGCCGACCTTCCTCATCCTCCAC
AACGGATCCGTCGTCGACACCATACAGGGCGCCAACCCGCCCGCGCTCACGGCGGCAGTCGAGAAGGCTGTCAAGCTGGC
CACGGGTGCCGCGATGGGCGCCGTCTTCTCTTCGCCTGGGCGGACCCTTGGTGCCGACACCGGCAGCAGCAGAAGCAGCG
GAGGCACGGCGGCACGTCGTCCATCAGCAGGCCCTATCCATGGAAGAGCTGGATGGGATCTGAACGGAATGGTGAATGCG
CTGATCACGTTTTTCGGCCTTTACTTTACTTCCCTGTTTTCTGTATGTTTCTCTCCTCTCGCCTTCTCAGCTTCGTGCAT
GGTGCATTCCCCGAACATGTGCTGAACAGTCTTATGCAGTTTGATGGCTACATGGCTGCTCAGAACTCACGGTTCAATGT
CCACAATCCGACGGTACCGATCAATACTGCTTTTGCTCCGATACGTACAGCTGGCTCTGGCGGCGGCAGCTCGGCTGGCA
CTTCCAGTGGCAAGGCAAGCGGCCCGGCTCGCAACCCTGCTCAGCCCCGGCCTACTTTCAAGACGCTGGCCGACCTGTGA
GTGGCAGCGCTGGACGTCATGTTGTCATGCTGTAATGTATGCTTGTTGCGTGCTTCTTGATATGGTTAGTGTTATCAGCG
ATTATATAATGGTCACGTGCTTTACAAATCCGTCTGCTACCGGAATTTTCAATCTCTGCACTGTGATTTGCAAGTCTGAG
CTCGTGGCATTGGACTGAACAATTCGCACAACTCGCCATGTTCAGCGGAAAGGAGCTTCAGCGAGCATGTCCGCGGTACC
AGACATGGCTGCGGCAGGTCTTTGAGAGCGGCGTCACGGCTGCGGCGAAGAGAGATGGTATGCAGCGACGCTTCTCTGCG
GCAGCAGCTTCAGGGCGCTCCAGAGCCTCATTCGGTCGCCAGGTCGCTCAACTTCGCTCCTTCTCGACGTCACGTGGCGC
TATACGTCAACAAGCCTCAGACGGTGGTGTGTCTGACGCGGAAGAGATTGAAGCTGTCGTGCGACAGGCTAGAGCTACAT
TTGGCGACACATTACCCAAAGACTACCTCACCAGCCAGGAATACAAGCTGTATGAACGGCTCTATGGTTCGCCTCTGCAT
GACACCCGTCCAGAGGATGTACGCATCACGCTGCAGCACCAGCTGGATGAGGGGAAGCACACGTTGCTGAGAGAGACCGA
TGGAGGGGAGCTAGAGGTTGTGGATTATGCTGTTGAAGGATTGCAGCTACGACAGGATGTCGACACAGAGGCCGTCGGAC
AGCCGCTGGAGAACACAGAGGTGGAATATATCAGTGCCGTCGTACGGAATCAGAGGGAGTTCAACGCTTTGCAGAAGCTG
CAGCGCGACTTTGAAGCAGCCACTCTAGAGGCGGCACGAGTGGCGAAAGAAGAAGAAAATGGAGAAGAGGAACCTGCCGA
GGAAGAAGAAGAAGAAGAGGACGAGGAAGAGGACAGAGAGGAAGAAGAGGAAGAGGACGAGGAGCCAGGGGCGATATTTG
GAGCAGGTGGTGGCGCTCTCGGGCGGTTGCACCCGTTCACAGTGCAGAACCGGTCGCGGACGAACCCGACGACGCTGCAG
CTGCCGAAGGCGGCCTTTGTTGAGCCTATAAGTGAGCTGCTGCGACGGACAGACTCGAAGCACATCCGCGAGGCAGCCGA
GAAGGTCTTTGGCGGGCGAGGGCTGCCGCACTCACCAGCATCGCCACGGGGCAAGATCGGAGCAGGACAGAAAGCGATCC
CAATGGAGGCAGGTCACCGGCGGATGTCGGAGATTGAGGCGGACACGTTTATCTCGACGGTGATGCCAGGGGTGTACGCG
ACAGCGATGAGTGCGCTGGTGGAGGTGCGGCGGCGGCTGGGATCAGGCTGGATCCAGGGCCTGCTGACTAAGAGCAACGG
CAGCAGCCTGCGGGTGCTTGATGTCGGCGGCGGCGGTGCAGCGCTGGCGGCGTGGAACGAGGTGCTGCGGTCAGAGGTGG
CAGCGCTGCGGGAGCGTGGTGCAGCGCCGTTTGACCGGACAGGCTTTGCTGAAGGCGAGGGCGAGCGAGAGCGCAGATCG
TCGGAGAAGATGGTGGTTGTGGGCTCAGACGCGCTGCGGCACCGAATCTCGCGTTTCCTGCACAACACGACTTTTCTACC
ACGACTGCCAGATCTGTTGCACTCGGCAGCCAACGTGGAGCGACACCTGGACGCGCCGGCCAGCTTACAGCCACGCAAGA
CGTACGACGTGATCGTGGCCAGCCACATGCTCATGCCGCTATACAAGGCATACCAGCGGCGGTCACTCGTGGCGAATCTG
TGGGCACAGCTGAACCCAGAGGGCGGCGTGCTGATCATTCTGGAAAAGGGCCATCCGCGCGGCTTTGAGGCGGTGGCCGA
CGCCCGTCAACGTCTGCTGGACGACTACATCCTGGGGCCGGGCCAAGAGGAGGCAGCCGAGACGCAGGACACGGCCGAGG
ACGAAGACGAAGCCGTGTCGTCGCCACGCCAACGGCTGCGCGAGCCGGGGATGATCATTGCGCCGTGCACGACCCACGGC
AAGTGCCCGATGTACCTGACGCCGGGCATCGCGGCGGGCCGCAAGGACTTTTGCCACTTCAGCCAGCGCTTCATCCGGCC
GCCGTTCCTGCAGAAGATCTTGGGCCGGTCGCACCGGAACCACGAGGACGTTGACTTCAGCTACGTGGCCGTGCAGCGAG
GCAAGCAGAACGCAAGTGCGGGTCTGAACGATGCTATCGCGCTGCAGCCGCTGCTGCAGGGCCGCGAGGCAGCCGACGCG
GCCTTTGCCGGCTACGAGCAGGTGGAGGGCGGTGGTGATGGCGAAGCCGCAGCCGTAGCCCCCCATCCTCTCTCGCTTCC
GCGCACGATTCTGGCGCCGCTGAAACGCCACGGTCACGTGATCCTGGACGTCTGCACGCCTGCCGGTCAGCTCGAGCGCT
GGACGGTGCCGCGGTCGCTGAGCCGACAGGCCTACCACGACGCGCGCAAGGCGCGCTGGGGCGACCTGTGGGCGCTCGGG
GCCAAGACGCGTGTCGTGCGGGCGGCGCGCGTCGGCCGCGCAGGAGCTGGCGGCAGCGGAAAGCCGGACAAGCCGCGGGT
CATTGACGTCAGCGTCAACGCGACAGGGATTGTCGGCGCGGCCGAGCGAGAGCGTCGCTCCGGCGAGCGGCGGTCCAAGA
AGAGCAGGAGGCTGCAGGAGCGGCGCGACCTGCTGGCGGACTTGCTCGAAGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62