GenePrediction:GLEAN_3038 Details

Name: GLEAN_3038
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:358351..358862 (+ strand)
Length: 512
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:358351..358366 (+ strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_160:358535..358642 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_160:358693..358862 (+ strand)
Length: 170
>GLEAN_3038 class=GenePrediction position=GCSC_160:358351..358862 (+ strand)
ATGGCGTGCCCCTTTTGTGCCACCCGCCTCACGACAGCCACCGGCGTGACCCATCATCTCGAGCGGGGAGCCTGTCCCAA
TGCGACCCAGCTCAATCGCGACGAGCTGTATCGCTTCATGCGGTCCAAGGATACGGGCGGGCGCATCTCAAAGAAGCTGA
TCGGCTAGAAGGGATCATCCCAAGTGGAGGCCACCGCGAAAGCCTGGAACGGTAGAGGCTACGAATGCTTCCTGTGCAAC
CGCGAGTTCCGCTCGCTGCAATCTCTGAACCAGCATCTCGGCTCGGGTGCTCGTACGTCCACGACCTTCCCTCTTGTCCA
TGTTCTCGCTAACACCAGCCAGACCAACGGGCGCTGTATCATTGTCCGCATACGAGCTGTCGTCAGGACTTCAAGACACT
GGCCGCTTTCATCAACCATTTGGAGAGCGAGGCGTGCGGCTTCATGCGCTTCTCCAATGTTCAGTCCAGCATCAAGGGCC
TTATCAGCGGCGACCGTCTGCTTGGCTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62