GenePrediction:GLEAN_3039 Details

Name: GLEAN_3039
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:362049..365226 (+ strand)
Length: 3178
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:362049..362162 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_160:362212..362531 (+ strand)
Length: 320
Type: CDS
Source: GLEAN
Position: GCSC_160:362605..362697 (+ strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_160:364239..365226 (+ strand)
Length: 988
>GLEAN_3039 class=GenePrediction position=GCSC_160:362049..365226 (+ strand)
ATGGATATGTCCGCCACCACCACTGCTGCAGCTGCAGCTGCTACCAGCAGTGCTGCATCTATGAGCATGGGCAGCAACAG
CTGCCAGATCTCTGTGGGCTCTCTCCCGTTCCATGTCAGTCTCCTCCAAGAAGATGAAAACTCACCGCCTCTTTCTCTCG
CAGATGCTGTGGAACTGGCACACTATCGACGCCTGCTTCGTCTCCGAGTCCTGGCATATCACCTCGCGTGGCATGTTTGC
CGGCTCCTGCATCGGCGTCATCTGTCTCGTCATGAGCCTGGAGATGCTGCGTCGGGCTGTCAAGGAGTTCGACCGCTTCA
TCGTGAGGCGTCACCATGCTGCCCTAACGGCCGCCAGCCCCAAGCATGGAAGACCGGCTTGCGATCCCGTCCTCGCTTCC
GGCTTCCGGCCCACCATCTTTGAGCAGGCCGTGCGTGCGCTCTTGCATATGCTCCAATTTGCAGTGGCATATTTTGTCAT
GCTGTCCGTGTTTTTCCCTGCTATACAGCCATGCCATTCATAACAGCAGCCGATCCTAATCGGTACCATCTTACAGGCTT
GCCATGTACTACAATGGCTACGTTATCATATGTATCTTCATCGGCTCCTACCTCGGTAGTTTTATCTTCCAGTGGGAAGT
CCTTGGCGGGTGAGTGTCAATAATATCTCGAGATGGGCGGCACACAAAAGCTAACGTGACAAACGAAAGATCAAAATTGG
GGGCCACTAGTGCTGCATCAGAAGCCACCGTGTGCTGTGGCTAATAGCAAAAAAACACTTTTCCTGTATGTATGCGTGGC
CATGGAAGAGTAGCTGCTTGCGAGTGTTATACCTTCTAACTCCGGGTCTTAACTCATGTATATTATATTCATGATATATA
GGACAAATACAAATGTGTGGGTAGGCTTTGTATGCACAGGCAAGTAAAGAGGCTTTTTAGCGAAAACTAGAACGTATTCG
CGCAGAATCGCCTCGTTGAGGCATGTGCTAAGGATTAGAATCGATGTCGTTCGATAATAGATGAAGGATGTATCGATTCA
AACTTGCGCAAACTTGCTCAACCGATGTCATTTACCATTGGACAACTGTACATGTGGACCGAGCCCTTGCTTTAACGAAT
GTTCACATGAAAAAAGGTACAGCCGATTCAGCAACCTTGCTTGCATTTGTTTGTGCCACCTCTTTATTTCGGAGTCCTGA
CAATAACATGGTTAGAGCGTTTTGAGCCACTCGTTTGTGCTAAGTTTAGAACATAGTATCTTATGATATAATTTTCGATC
ACATGACCTGAAGATGTGTTAATCAAGCAAAGAAAACTCAAAACTTACCAAATCTCTCTGTGCCAGTCTCTATCAGTCCC
TGAAACAGTTGGTAGACAGAAGGCAATGGAGATAAACAGCAGGCGCGGGAGCGCGACGGAGTGAAAGTAAACAAACATAT
TTTAGTCAGAAACGTCCCCTTCATAGGTCATGGGATGGCGAACTTCTCGGCGGTCAGAAGGACTATTTAGTAGCGACCAC
CGACAACTCGCCTGAAACGATGTACTCGTACTCCGTATTTTCAGATTGTAAAAGAGGAGTGAGAGAATGGCGGAGCTCGG
ATGTAAACAGTCCCGACTAAGGCGAACGCCGGTTGTAGATGCCCCGTAACTCTAGGCGGAGGAACTATTAGCTCCAGATA
GACTACAACGTGCCCAGCTTTTGTGCGGAGTACGGAGTACGTAGTAATATATTATTCATTTACTCATAGTTCCGAATACC
ACCGACGGCCGCATTGTCTCGGCAATCATTCATTACGACGTACAAGCAATTTATAACTGGGGATGGTGTACGCGTACGCG
AAGATCACGGTAAGGCACGCCCAATATTTATTCGTAAAGCAAGGAATCCCACTCCGAAAGGCGGGTTATATAAACCAGTA
ACAAACCGAGAGGTGTCAAGTTGAGCACTGATAACGACTACACTCCTTTCGCTCCTGTCAGTTTCATACCGCGACAACGA
TAACGACAATGTTCTCCAAGAGCAGGGCTTCCTTGCTTGCCTCGATTGCAGCTTTGGTATTGCCTTCTTCCTCCACACCA
ACCCACAAGGAGATCACTATCCCAAACTCGGGTCCAACTTGCTATGATTTGTTCATTCCGTTGGAGGTCACAAGCCGGAA
TCGCCAGTTCAGTGAAACCACTCTCGACAGTGTAAGCTCCGTTGGGAGGGAATTAGCTGCTCTGAAGTCGTCGACCGCAC
CTTTCGTCACCGTCACTCAGAATGTCAACGTCAGTGCTCGGTATTGCGAGCCTGAAGTCGAGGTTCCCGGCCGCGAGAAT
TCCATCCAGGTCCTCGTTCACGGCATCACTTACAGCAAAGTTTATTGGTCCGCACTTGGTTTTCCTGGCTACCAGCCGCA
GAACTATTCATGGGTAGACTTCGCCTCCAAGAACGGATATGCTACCCTGGCCATCGACAGACCTGGAAATGGAAACTCTA
GTACCCCAAACCCGTTTACAGAGGCTCAGATTCCCTTCTTCGCTTCTATGCTTCGAGACATTGCAGATGGACTAAGATCA
GAGAAGTGGCTTTCTCATTCCTTCGACAAACTCATATATGTTGGCCATTCATTAGGCTCAGTGATTGGCAACGCCATCGC
GGTAACATATCCCGACAGTTATGACGCCATGGTTCTGACGGGATTTTCCAAAGAAGTCGCTTCAGTTCTCGTCAGCATGG
GGATAACAGTACCGGCTGCTACGTTCAATTCCAAATTTGCAGACCGCAGCACTGGCTACATTGTTACCTCCAGCGAAGAG
GGCCGGCGAAACTTTATGTATGGCACAAATGATACATACGACCTTGCAATCACTGGTCGTGATTACAACCAACAGGGTGT
CACTGCCATTGCTGAACTAGCAACAATTACGTTCCCGGTAGCTTCGAATTTCACCGGAGCTGTCACTGTCGTGACCGGCC
AGCAGGATGTAGCGTTCTGTTACGGAAACTCGACCATTTTGGGAGACTGTGGCCAGGGAGACTCATCTTTGCCTGCTCAG
GCACAGACTCTTTTCCCGAACGCTTCGTCTTTCGCTTATTATGTCCCGGAGCAAATGGGACACGATCTCAACTTGCACTA
CAAGGCACGTGACGTCTTCAAGTATGTTCACGACTGGCTTGCAAAAACCGCGTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62