GenePrediction:GLEAN_303 Details

Name: GLEAN_303
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:917283..918888 (+ strand)
Length: 1606
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:917283..917339 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_167:917434..917558 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_167:917624..917665 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_167:917781..917851 (+ strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_167:917935..917968 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_167:918040..918129 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_167:918192..918888 (+ strand)
Length: 697
>GLEAN_303 class=GenePrediction position=GCSC_167:917283..918888 (+ strand)
ATGGCCGACCCAACACTCCAGCCGCCGCAGCACTGGACCGACCTGCCGGAAGAAGATGTGGGTTCTCTACCATCCTCCGT
GGAAATGTGGTCCGGCCCACTGGGACGTCGTTCCTGACGGGTACGGGGTACTGAACAGACTCGTTGCCCAGGACACCGAC
TCAGCCCTCGGCGATGACGCCGCCAGCTCGACGGCTTCAATAACGTCCAGCATCCTGCAATACCGCACGATCAACGGGCG
CACGTACCACAGCGACATGGGAAATAACAACTATTGGTGCGCTACGTCCAAGAGCACATATGCTGCATCGGTTGTGCTTC
CAGCTGACTATCGCACTGCAGGGGCGCGAATGACGAGCGGCAGAACGAGACGCTGGACATCCAGTAAGTAGTATCGCCCC
CTCTTTTAGCGACTGAGGTTCTTGGGGGTCTTGGGGGCCAAGAATTAGTGGATCAGCTGCTCCGGTTTTCTCTTGGTTGC
GCTGACCGAATTGCACAGACACCATTTGTTCACGCTCAGCATGGATGGAAAGCTCCACTTTGCACCGTTGAAAGACGACA
TTGAGGCAAGTTCGACGGCACGCCCACGCAGCGAATTGCAAAGAGCAGAGACATTGTAGAAGAAGTCAACTAACATGCAG
TCTAGAACGCAGTTGACATCGGAACCGGCACGGGCCTCTGGGCTATGTGAGCACCTATCACGCCTAGTCTAGAAATCTTG
GACCAACGCTAACAGGGATATGATATCCTCCACGCAGTGACTTTGGCGACCAATACCCAAACTGCAAGGTAATCGGCACC
GACCTCTCGCCGATCCAGTCGCCATGGGTGCCGCCCAACGTGCTCTTGTAAGTAGATGCGGTGTGGTGTGGTTGTCGGTA
GAGGATCGTTGCCGACTGACCTGTTGCAGCCAGATTGACGACTTCACGCTCGACTGGACGTTCAGGCCCAACTCGCTTGA
CTTTGTGCACACGCGCTGGCTGATTGGCAGCGTGCCCGACTGGACGGTGCTGATGAAGCAGGCGTACGCGGCCCTCAAGC
CCGGCGGCTGGATCGAGACGTACGAGTGCAACGGCTTCTTCCAGTCGGACGACGACTCCGTGCCCGAAATGAGCGCCCTC
GCTCAATGGGGCGTCATCTTCCGTGAAGGTGCCCGGAAGCTCGGCTCAACCTGTTCCTTCAGCGTCCCGCGCGACGGGGT
CCAGAAGAAGGCGGCCAAGGCGGCCGGTTTCGTCGAGATCCACGAAAAACTCCTCAAGATCCCCATCTCTGAGTGGTCCG
ACGACCCGAAGCTGCGCGAGATCGGCCTCTACTCGCGGGCCGCCATCGAAAATGACACCGAGGGCAGCGTAGGCCTCCTG
GCCGGACAGCTCGGCTGGTCCAAGGAGGCCATCCATGTCTACGCCGCCCACGTGCGCAAGGAGCTGCGCGCGCTCAAATC
CCATGCCTATTACAATTCCCTCGTGGTCTGGGCCCAGAAGCCGCTGGTGGAACAAACGCCGCTGCCAGAGGAAGAGCCGG
TGCTAGTGGAAGCTCCTCTCGACGAAGTACCCGTGCCGGCTGAAGCACCAGTGCCAGCGGCAATACCGGCTCCAAAGGAA
GAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62