GenePrediction:GLEAN_3041 Details

Name: GLEAN_3041
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:395823..396558 (+ strand)
Length: 736
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:395823..395864 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_160:395923..395957 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_160:396027..396558 (+ strand)
Length: 532
>GLEAN_3041 class=GenePrediction position=GCSC_160:395823..396558 (+ strand)
ATGTCTGCTGCAGAGCCGCGAGTCCTGATAAGGGAACCATTGGTATGTCTGCCTCTTCCGCCTCATTTCACAATCGCTTT
CCGCTAACACATCCCCACAGCCGGCCAGTGAGGCAAAATGGACCAAGCTAGTCAAGTAAGACGACCTCCGCACATCACCC
AGCCCAGCCATAAGCTTACATTGGCCCCCCACATCGCTCTTTAGGGTGACCTATGAGGACGGCCTAAGAACCAGACGCGT
CTGGGAATCTGCCGAACGCACCACTCGGCCTCTAGGCAGCGACATTGACGGTGTCGACATCATCGCCATCGTAAAGGGTG
GCACTGACGCCGACGAGTCGCTCATCGTCCTCGAGAAGCAGTTCCGCCCTCCCGTCGGCCGCACCGTCATCGAGCTGCCG
GCCGGCTTCGTTGACGAGGGCGAGACGGCTGAAGAGGCTGCTGTGCGTGAGCTGCGAGAAGAGACTGGCCTTGTCGGTGT
CCCCATTGCCGCCAATGCCGCTGTCTTCACCATGTTTGCCGACCCCGGCTTTGGAAATAACGATTTGCGCATCGTCCATC
TGGCTGTCGACAGCCGTCTTCCCGAGAACCGAAATCCCCATCCCGCTCTAGAAGACGGTGAGCTCGTCCAGGATGTCTTC
TGTGTGCCGCTCGACCGACTGCACGACGTCTGCCAGAACCTCGCCGCCGAGGCCCTGGAGATGTCCAAGCGCCTCCTGCC
AAGGCTGTCTGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62