GenePrediction:GLEAN_3043 Details

Name: GLEAN_3043
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:405448..407543 (+ strand)
Length: 2096
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:405448..405592 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_160:405656..405808 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_160:405871..406244 (+ strand)
Length: 374
Type: CDS
Source: GLEAN
Position: GCSC_160:406324..406417 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_160:406480..407306 (+ strand)
Length: 827
Type: CDS
Source: GLEAN
Position: GCSC_160:407385..407543 (+ strand)
Length: 159
>GLEAN_3043 class=GenePrediction position=GCSC_160:405448..407543 (+ strand)
ATGACAAACACGAACCGGTTCTCGTCATACACGTCTGTGTCGGTTGGATCCGACACCGACAAGAAGAAGGAGGACCTCTG
GGGATCCCTGCTGGAGTCGGTGGCCAGCGCCCGTCGGCTGCCGGAGCGGAATCTGCTAGTATTGGGTGAGTGGACTGCTT
CGCTCTCCGTCTCCCGGAAACGAAGGCTAATCTTTGCTGCTCTGCCAGGCGGAACGGTCGATTCGCAACGCGAGTTCCTC
GAGTCGCTTTCGCACAACCAGCTGCGGCGCAATCTGGACCGCCAGCAAAAGTTTCCGCCTGTTGCCAACAGTCTCGCACT
GGGCTACACATACTATGATGTCTTGGATGCCGACCAGGAAGGTATGTCGTTGCTGCCGGGCTTCTTGCTGACCTGTTCTG
CGCCCATGCTCATGCTTTTGCAGATATCCTTGCCCGCATCTCCCTCTATCTCCTCTCGAAGCCGTCGCCGTCGTTTGGCT
CTCTCATCCAGCCGCTCCTCACGCCCGAGTCCATATCCAACACGCTGATCGTCATCCTGCTCGACTGGTCGCAGCCGTGG
TTGTGGCTGCGCCAGCTGCGCGAGTGGATTTTGCTGCTGCGCACCGTGCTGGTCTCGCTGAGCGCCGAGTGCAAGGGCGT
CATGGAAGACGCCATGATGCGGTGGCGTGAGCGTGGTCGCGGAGGGCCCGTCAACCTGGACGGCACCACTGCCACGGTCG
ATGCTGACGTCCTGCCGCCTGGGCCGGGCGAGTGGGAGGACGCGCTGGGACTGCCGCTGTGTGTCGTGTGTCAGAACGTG
AGAAGCTTCCGGGGCCTTGTTCGATGGTCGCTCGTTTGCCCTTGGCCCTTTGCTCGCCGCTAATCCGCCGGAATAGTCCG
AGAAGACCGATATACTCGAAAAGACACAAGGTTGGAAGGACGACGAATTCGATCTGGTGCTTCAGTATCTGCGGACTGTC
TTGGTCAAACGTGCGTTGTCCTCTTGTCCTGCAGAGGGTAGATGGTGGTAGCGATGCTGACCTCGGATGCAGACGGTGCC
TCGCTCATCTACACCACGCCCGACGTGCCGTCCGAGCTGCCGACGCTCGTCCATGCCTGTCTCGGCGTGACGTCGCTGCT
CAAGCGGCAGCCGCTCAAGCCTGAGGTGATCAAGCGGACAGAAGTGATCGTGCCGTCGAACTGGGACTCGTGGACCAAGA
TCCTGGTCGTGCGCGAGGGCTTCGACGTCGAGAAGGTGAGCGAGGGCTGGTCCAAGGACCTGCAGCGGCCCTTTCCCGTT
CCACCAAGGCGGACCAACGGCAAGGACGAGCGGACGAGGATAGCAGGCGAAGGTGCACGCCACGACGGCGACCCGGCCGC
AAACGAGCCGTCTTCCGGCGACGCGAGCGAGTACTACTACGACAACAACACCGGGCTACAGGACGGCGACGACGGCGACG
ACTTCCAAGACTCGCCAGACTCGGCCGTGGCCCAGTACGAGCGCACCATTCGTGATCCCGGCCTGGATGCCCTCTCGCTC
GCCGGCCAGGCTGCCCACCCGACTACCCACCTCGAGGTCGAGACCGAGGACGTCCAGGGCTTCCTGGCCGAGCAGCTCAA
ACTGCTGGACCAGCTGCGCCAAAAGGACGATGCCAAGCGCGAAAAAGAGGCCAAGGAAGCTGTCAAGGGTGCACGGGGCC
CCTCTTCCTCGCTCTCTGGATCGGCTGCCCCCATGGGCCTGCTCTCGTCTTCCTCGCTCGGCTCGGACGGCGGTGCCGGC
GGCGACCCGGCCGAGGTCATCAGCAGCCACATCGGGCCCGTGCAGTTCAACATTGGCGGCATCCAGGTCGACGCCGACGA
CATGCTGGAGCGCATCAAGGTGTGTTTTGTGTTTCCGTCTTTATTTTTTCCTCTGTCGTCTTCGTACTCGCAGTCTCTCC
TGCTGACCGCCGCACAGAACCGTCACGGATTTGGCTCCAACGACGATGCAGCAGATGTCGAGACGGTCACCATCGGCAGC
GAGGCTCCGCGAGCATCCGAGAATGTCGACACCGAGAAGATGTCGGCCTTCTTTGCCGGCCTGATGAGCCGGCAGAGCCA
GGCTGGCAAGACTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62