GenePrediction:GLEAN_3044 Details

Name: GLEAN_3044
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:411332..412514 (+ strand)
Length: 1183
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:411332..411387 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_160:411457..412076 (+ strand)
Length: 620
Type: CDS
Source: GLEAN
Position: GCSC_160:412129..412514 (+ strand)
Length: 386
>GLEAN_3044 class=GenePrediction position=GCSC_160:411332..412514 (+ strand)
ATGAATAAAATACGGCAGATCCAAGAGCTCAACAAAAAGGAGCTTGAGCAGGGAATGTAAGTTCCGGCTTTCTGTACAGC
GGGAGGTCCCAGGAAGTCTCGCCCTCTGCTGACATGTGCTTCCAGCTCTCCACAGGCCTCCTGGCATACCGACTATCGCG
ACACTGCCTTTGTATACTTTGGCGGCCTCCCATTCGAGCTCTCGGAGGGTGACGTGATCACTATATTCTCACAGTACGGC
GAGCCCGTGTTCCTCAAGCTTGCGCGCGATCGCGAAACGGGAAAAAGCAAGGGGTTTGGCTGGCTCAAGTACGAGGACCA
GCGCAGCACCGATTTAGCTGTAGACAACCTTGGCGGTGCTTCTATATCTGGTCGCTTGATACACGTGGATCACGCCCGCT
ACAAGGCGCGTGATGACGAGGACCTCGACGAGTATAAGGTTGGGTGGGAGGACATCCGGCGGCGAGAAGGCATCGTGGAC
GCCACGGCAGGCGGGAACAGCGAAACGGACGGCGATGGAAAGTACGAGACAGAAAGCGACACTGAAAAGCGACGGCAACA
CCATCGACGGCGGGTGGGAAAAGGAGAACGGCCGATGCTGCCAGAAGAGCGCGAGCTCGAGCAGCTGATCCGGGATCATG
ACGACGAAGATCCCATGAAGGAGTATCTCATCGACGAGAAGAAGAAGGAGATCGAAGCTGCACTACGGAGAATCGAGGAC
GGCCACGGCGATGAAGGCAAGGATCGTCACCACCGACACAGATCACACAAGTCGCACAGATCCCACAGATCCCACAGGTC
GCACAAAGACGGAGACATCATGGATGTTGACTCAGACGACAAAGAACACTCTACCCGGAAGCCAGCGCGACACGAGGGTG
AAGCGGACGACCAGCGAGAGCGACATCACAGGCGCGAGGAGAGAGATGGTCGAGAACGCAGCCACAGAGATAGAGACCGT
GATCGGGAAAGGCACCGGGACAGCGACCGTGACACAGGCCGAGAACGGAGACGCGACGACCGCGACGAAACTGCAGCTCG
TGACGGCAGACGAGAGCATAGGGATAGACACAGTCGACAGCGGGAGTGGGATGACGATGGAAAGGGAAGATAGCCTAGAA
CGCGGCGGCATGGAGAGTAACCAGAGACGATCTGCTCTGTATTTGCACAGTTGCAATTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62