GenePrediction:GLEAN_3045 Details

Name: GLEAN_3045
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:415338..416960 (+ strand)
Length: 1623
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:415338..415352 (+ strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_160:415502..415577 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_160:415655..415771 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_160:415845..415932 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_160:416000..416137 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_160:416206..416673 (+ strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_160:416726..416960 (+ strand)
Length: 235
>GLEAN_3045 class=GenePrediction position=GCSC_160:415338..416960 (+ strand)
ATGTCTTCGCCTGCCGTACGTCCTACGTCCATGACTCCAATCAATCTAGCTCCGGTGAAACAACTATCCCTATCCCGTAC
TTGGGACAGGAGAAGAGAATGCCTTGTGGCCCAACTCGTCACCGCCCTGGTACTATGTGTCGCTAACCACAACCCCATGT
GTAGAAGATGATCCGTCGCAAGAAGAACGTGAAGAAGGGAATCCAGTTCTGTCTGATGGTCTGCGGCGCTTCCGGAACTG
GTGCGTCTGCCCCGTTCACACTTGCTGTCGATCCTGTCTTCTCGAACGAAAGCTGACATGTGTTCGACATACGATAGGCC
GGACCACATTCGTCAACACCCTTTGCAGCAAGGGCGTGCTTTCGCACAAGGAGTCTGACGACCCCAACACTGCTCACGTG
GAGGAGGGCGTCAAGATCAAGCCCATCACTGTCGGTATGTATTACAACACTCACCGTCCACCGATCCATTTCGGCAACTT
CGAAACGCACATGCTGATTACCTCTAGAACTAGAGCTGGACGAGGAGGGTACCCGGATCTCCCTCACCATTGTTGACACA
CCCGGTTTTGGCGACCAAATCGACAACGAGGCCAGGTACGTGATACCACCTTTGACCGCAACTCAGGGAGGCTGCATTCT
AACCTGACCACCTTTCATGCAGCTTTTCTGAAATCGTCGGCTATCTCGAGAGGCAATACGATGACATTCTTGCAGAGGAG
TCCCGAATCAAGCGTAACCCGCGTTTCAGAGACAACCGTGTCCACGCGCTCCTCTACTTTATCACGCCGACCGGTCACGG
GTAGGTGCATGCCCAACAAACGGCGTCCCGTCGCCTGATGCCTTGAGCTTCGCTGACCCCTGTCTTAGTCTGCGTGAGCT
TGACATCGAGCTCATGAAGCGCCTTGCTCCCCGCGTCAATGTCATTCCCGTTATTGGTCGCGCGGATTCGCTTACACCGG
CTGAGCTTGCCGAGTCAAAGAAGCTAGTCATGGAGGACATTGAGCACTACCGCATCCCCGTCTACAACTTCCCCTACGAT
ATTGAGGAGGATGATGAGGATACGGTCGAGGAGAACGCCGAGCTGAGAGGCCTCATGCCGTTCGCTATCGTCGGATCAGA
GGACATCATCGAAATTGGCGGCCGCAAGGTTCGTGCTCGTCAGTACCCATGGGGCGTCGTGGAGGTCGACAACCCGCGCC
ACTCGGACTTCCTGGCCATCCGCTCGGCTCTGCTGCACAGCCATCTGGCGGACCTGAAGGAAATCACACACGACTTCCTC
TACGAGAACTACCGTACCGAGAAGCTCAGCAAGAGCGTCGAGGGTGGTGGTGCAGCGTACGTGTTTCCCGCTGGCCGTGG
TATTGTGCTCTGCTAACATTCTTTGCAGCGATTCGTCCATGAACCCCGAGGATCTTGCATCGCAGTCTGTCCGCTTAAAG
GAGGAGCAGCTGCGCCGCGAGGAGGAGAAGCTGCGCGAGATCGAGGTGAAGGTGCAACGCGAAATCAACGAGAAGCGCCA
AGAGCTTCTGGCTCGCGAGTCCCAGCTTCGCGAGATCGAGGCCCGCATGCAGCGGGAGTCCGGCGGTCAGATGGACTCCA
ATGGCGATCACGAAGGCAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62