GenePrediction:GLEAN_3046 Details

Name: GLEAN_3046
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:420366..422090 (+ strand)
Length: 1725
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:420366..420615 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_160:420671..420984 (+ strand)
Length: 314
Type: CDS
Source: GLEAN
Position: GCSC_160:421057..421344 (+ strand)
Length: 288
Type: CDS
Source: GLEAN
Position: GCSC_160:421404..422090 (+ strand)
Length: 687
>GLEAN_3046 class=GenePrediction position=GCSC_160:420366..422090 (+ strand)
ATGGCATCTCCCACACCTCCGACCGGCATGGCCGAAATTTCGGAAGCTCAGCAGGCTGCGGCGCCGTCGCCGAGACGGTC
TGTCAAGCGAGTTGCGTTCGCAAAAAGCACCAAAAGCGGCAGCGGCAACAGCAACAGCGGCCCGCTCTATATGCAGACCT
CTGGAAATGTCGTGATCGTACGGCGGATCAAGAGAAAGAACGAGACGCCCACGAAGCAATTCACCCGATGGCTGGTCGAC
AACCAAACTGGTACTTTTTGCATGTATCCTCTTGCTCTTCTCCTCCTTGCTAACCGCGCCGCCAGGCCTCTCCTTCAATC
TGCTCGCACTCCTCTTCCTTACCCATATCTTCTTTCCCATGCTGCGCACCCATACGACCAAGCTATTCACACTTTCCTAC
TACAACCCCTCAACTGGCCGATACAACCTGGGCAAGGATGACACGCTCTTTATCCTCTTCGGCGTCACCCTCCTGACCGG
CCTGCGTGCCAGCTCCATGGAGTACATCCTAGCACCTTTCGCCAAAAGCCGCGGCCTTTCCAAGAGGAAAACGATCACTC
GCTTCAGTGAACAGGCCTGGATGCTCATATACTATGGCATAATGTTCCCGTTGGGCTTCGTGAGTTGCCACCCTGCGCAC
TTGGGAGACCAAGCCTGATTTCCCAGCGGCTAACAGGCAGTCTTGTTCTAGTATCTTTACCAGCATTCGCCCTGCTTCAT
GAACATGGAGCACATCTGGTCAGACTGGCCAAACCGTGAGATGGATGGCCTTATGAAGGGCTACATCTTGATGCAGCTCG
CCTTCTGGTTCCAACAGATACTTGTGGTCAATATCGAGGAGCGTCGCAAGGACCACTGGCAGATGTTGAGCCATCACTTT
ATCACGGTTTCGCTGATTTTGATTTCGTACCGTTACCGCTTCACCCGCGTTGCCAATGTGATCCTTATCCTCATGGACGT
CAGCGACTTCTTCCTTCCGGTAGGACGCCCGAGTACAGCTTTCTTTTTGCTGATGCATTTCACTGACACAAACCGCAGCT
GGCCAAATGTCTCAAGTACTTGGGCCACACCACCCTTTGCGATGTCTTCTTCGGTTGCTTCATGCTGAGCTGGTTTATTC
CCCGCCACATTTTCTTCTCCATGATCTGCTACTCTGTATGGGCCCAGAGCCAAGAAATCATGCCACCAGGCTGCTTTCGG
GGCGGTCCGGGCGGCTCGAGCATCCTGGTCAGCCCAGATGATATCTCACCACTCACACCCACCATCTCGGCATTTACTCC
TTTCAGCCCCACCACAAGCAACAAGCTTGCTTACATGCTCGAGGCCATATTTGATTCGGACGGTGCTATATGCTACACCA
CGGTGGTCAAATGGTGCTTTTTGTCGATGCTTCTCCTCCTTCAGACTCTGATCAGCGTCTGGTTCGTCATGATCGTTCAG
GTCGCCATCCGCGTCGTGAAGGGTGCCGGCGCAGAAGATTCGCGTAGCGACGACGAGTCGGACGAGGTTGAGGAGGACGA
AGAAGACGAAGAAGACGAGTTTGTGTACGAGGAGGCTCAAGCACTCGAGGAGGAGGTTGGCGTTGAGGACATTGACTTCA
AGGGCTGGGAGCGGCGGTCTGGCCTCAAACGGCCGGTATCGTCAACATCGGGCGTCAGCCTGCCCGGTCACAGTGATCGA
AAGGAACTGCTGGGGCGCATTGGGTGCGAGAAACAGGTGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62