GenePrediction:GLEAN_3047 Details

Name: GLEAN_3047
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:430349..431732 (+ strand)
Length: 1384
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:430349..430574 (+ strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_160:430916..431559 (+ strand)
Length: 644
Type: CDS
Source: GLEAN
Position: GCSC_160:431613..431732 (+ strand)
Length: 120
>GLEAN_3047 class=GenePrediction position=GCSC_160:430349..431732 (+ strand)
ATGTCCTTGTTTGGGGCAAAGCCCACGACTGGACTGTTCGGCAGCAGCACGACGGCAGCATCGCCCTTTGGACAGCCAGC
AACCAACGCCCAACCAACGGGTGGCCTTTTCGGCACGGCGACGGCAGCTACAGCACCGACCGGAGGCCTTTTTGGAAGCT
CGACAGCAACAAAGCCAGCCGGCGGCTTGTTTGGCGCTTCTACACAGGCTACGCAGCCTTCGGGAGGTCTTTTTGATGGA
CCGATACAGACAGCACAGCCAGCTTTGGGGTCCAGCCTCTTTGGCTCGACACAACAGGGACAGCAGCAGCAACTCCAACA
GCAGCAGCAGCAACAGCAACAACAGCAACAACAGCAACAGCAGCAACAACAGCTGCAGCAAATGCAGCAAATGCAACAAC
AGCAACAACAGCAGCAACAACAGCAGCAGTTTGCAGCAAGCCAGTCTAGCTTATGGGGAAGCTCGCTATGGCAGCCAGGG
CAGCCTGCCGCGCCTCGTACGTACCGTCCCCATCTCTTCTATGTATGTATCCTATGTGGGACACGGGCTGACGACAGCGA
TGGACAGTGGAGAAGCCGATCCCGGATCAGATTGCCACGCTCATGGGTAAGTGGCGGCCGGACGTGCCGACGACGGTTTT
CAAGGAGTACTTTTACAACAAGGTGGACGAGAGCCGGGTGCCGTTTTTTCAGCCGCAGGCGTTTGAGAACCCACGCGATT
GGGAGGAGGCGCTGCAGAACAAGCCGGCGCCGGGCTACTTGCCGGTGCTGTGCACGGGCTTTGAGGGTCTGGCGACGCGG
CTGCAGCTGCAGCGGCGCACGGTGGCGGCGTTCAACGCAGGCCTGCACGAGATCAACACGAAGCTAGACTCCATCTTGTC
GCAACACGACCTGCAGACGAGTGTGCGGGCGCTGGCGGCGCGGCGGCGACACGCCGAGCTGAGCCGGCGGGTGCTGGCGC
TGGCCGCCAAGACGCAGGTGCTGCGCAACCGGGGCTACGCCCTGTCGGGTGACGAGGATGACCTGAAGCAGAAGCTGCAG
GCGATCGAGAAGACGATGCAAGACCCGGCACTGAGCGCGCGCATGGAGGAGCTGTGGAGCCGGCTGATCGTGCTGCGCAA
CTATGCTGATGCGCTGCGGGTGGAGGTGAACAAGCGCGGCGTGCGCGAGGAGGAGGGTCTAGGCGAGGACGTCGAGGCAA
AGGCAAAGAAGGTTGGCAAGCCCTGTTCCTTGTGTTGGCATCGTGCCAAGCTAACCGTCGACAGATCGTCGAGGACTATG
AGAAGCAACTGCAGCACCTCAAGAAGGAGGTGGAGCAGATCAAGGTAGACTTTGAGACGTGGCAGAAAGACAACCCACAG
GCCGGGTTTGCGGCAGCTCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62